Bio::Tools::Run::StandAloneWUBlast man page on Pidora

Printed from http://www.polarhome.com/service/man/?qf=Bio%3A%3ATools%3A%3ARun%3A%3AStandAloneWUBlast&af=0&tf=2&of=Pidora

Bio::Tools::Run::StandUsereContributed PeBio::Tools::Run::StandAloneWUBlast(3)

NAME
       Bio::Tools::Run::StandAloneWUBlast - Object for the local execution of
       WU-Blast.

SYNOPSIS
	# Do not use directly; use Bio::Tools::Run::StandAloneBlast

DESCRIPTION
       See Bio::Tools::Run::StandAloneBlast

FEEDBACK
   Mailing Lists
       User feedback is an integral part of the evolution of this and other
       Bioperl modules. Send your comments and suggestions preferably to one
       of the Bioperl mailing lists.  Your participation is much appreciated.

	 bioperl-l@bioperl.org			- General discussion
	 http://bioperl.org/wiki/Mailing_lists	- About the mailing lists

   Support
       Please direct usage questions or support issues to the mailing list:

       bioperl-l@bioperl.org

       rather than to the module maintainer directly. Many experienced and
       reponsive experts will be able look at the problem and quickly address
       it. Please include a thorough description of the problem with code and
       data examples if at all possible.

   Reporting Bugs
       Report bugs to the Bioperl bug tracking system to help us keep track
       the bugs and their resolution.  Bug reports can be submitted via the
       web:

	 http://bugzilla.open-bio.org/

AUTHOR - Peter Schattner
       Email schattner at alum.mit.edu

MAINTAINER - Torsten Seemann
       Email torsten at infotech.monash.edu.au

CONTRIBUTORS
       Sendu Bala  bix@sendu.me.uk (reimplementation)

APPENDIX
       The rest of the documentation details each of the object methods.
       Internal methods are usually preceded with a _

   new
	Title	: new
	Usage	: my $obj = Bio::Tools::Run::StandAloneBlast->new();
	Function: Builds a newBio::Tools::Run::StandAloneBlast object
	Returns : Bio::Tools::Run::StandAloneBlast
	Args	: -quiet => boolean # make program execution quiet
		  -_READMETHOD => 'BLAST' (default, synonym 'SearchIO') || 'blast_pull'
				  # the parsing method, case insensitive

       Essentially all BLAST parameters can be set via StandAloneBlast.pm.
       Some of the most commonly used parameters are listed below. All
       parameters have defaults and are optional except for -p.

	 -p Program Name [String]
	       Input should be one of "wublastp", "wublastn", "wublastx",
	       "wutblastn", or "wutblastx".
	 -d  Database [String] default = nr
	       The database specified must first be formatted with xdformat.
	 -E  Expectation value (E) [Real] default = 10.0
	 -o  BLAST report Output File [File Out]  Optional,
		   default = ./blastreport.out ; set by StandAloneBlast.pm

   wublast
	Title	: wublast
	Usage	:  $blast_report = $factory->wublast('t/testquery.fa');
	       or
		      $input = Bio::Seq->new(-id=>"test query",
					     -seq=>"ACTACCCTTTAAATCAGTGGGGG");
		      $blast_report = $factory->wublast($input);
	       or
		     $seq_array_ref = \@seq_array;  # where @seq_array is an array of Bio::Seq objects
		     $blast_report = $factory->wublast(\@seq_array);
	Returns :  Reference to a Blast object
	Args	: Name of a file or Bio::Seq object or an array of
		  Bio::Seq object containing the query sequence(s).
		  Throws an exception if argument is not either a string
		  (eg a filename) or a reference to a Bio::Seq object
		  (or to an array of Seq objects).  If argument is string,
		  throws exception if file corresponding to string name can
		  not be found.

   _generic_local_wublast
	Title	: _generic_local_wublast
	Usage	:  internal function not called directly
	Returns :  Blast object
	Args	:   Reference to calling object and name of BLAST executable

   _runwublast
	Title	:  _runwublast
	Usage	:  Internal function, not to be called directly
	Function:   makes actual system call to WU-Blast program
	Example :
	Returns : Report Blast object
	Args	: Reference to calling object, name of BLAST executable,
		  and parameter string for executable

   _setparams
	Title	: _setparams
	Usage	: Internal function, not to be called directly
	Function: Create parameter inputs for Blast program
	Example :
	Returns : parameter string to be passed to Blast
	Args	: Reference to calling object and name of BLAST executable

perl v5.14.1			  2011-07Bio::Tools::Run::StandAloneWUBlast(3)
[top]

List of man pages available for Pidora

Copyright (c) for man pages and the logo by the respective OS vendor.

For those who want to learn more, the polarhome community provides shell access and support.

[legal] [privacy] [GNU] [policy] [cookies] [netiquette] [sponsors] [FAQ]
Tweet
Polarhome, production since 1999.
Member of Polarhome portal.
Based on Fawad Halim's script.
....................................................................
Vote for polarhome
Free Shell Accounts :: the biggest list on the net