Bio::Map::MicrosatelliUser)Contributed Perl DocumenBio::Map::Microsatellite(3)NAMEBio::Map::Microsatellite - An object representing a Microsatellite
marker.
SYNOPSIS
$o_usat = Bio::Map::Microsatellite->new
(-name=>'Chad Super Marker 2',
-sequence => 'gctgactgatcatatatatatatatatatatatatatatatcgcgatcgtga',
-motif => 'at',
-repeats => 15,
-repeat_start_position => 11
);
$sequence_before_usat = $o_usat->get_leading_flank();
$sequence_after_usat = $o_usat->get_trailing_flank();
DESCRIPTION
This object handles the notion of an Microsatellite. This
microsatellite can be placed on a (linear) Map or used on its own. If
this Microsatellites will be used in a mapping context (it doesn't have
to, you know) it can have multiple positions in a map. For information
about a Microsatellite's position in a map one must query the associate
PositionI object which is accessible through the position() method.
FEEDBACK
Mailing Lists
User feedback is an integral part of the evolution of this and other
Bioperl modules. Send your comments and suggestions preferably to the
Bioperl mailing list. Your participation is much appreciated.
bioperl-l@bioperl.org - General discussion
http://bioperl.org/wiki/Mailing_lists - About the mailing lists
Support
Please direct usage questions or support issues to the mailing list:
bioperl-l@bioperl.org
rather than to the module maintainer directly. Many experienced and
reponsive experts will be able look at the problem and quickly address
it. Please include a thorough description of the problem with code and
data examples if at all possible.
Reporting Bugs
Report bugs to the Bioperl bug tracking system to help us keep track of
the bugs and their resolution. Bug reports can be submitted via the
web:
http://bugzilla.open-bio.org/
AUTHOR - Chad Matsalla
Email bioinformatics1@dieselwurks.com
CONTRIBUTORS
Heikki Lehvaslaiho heikki-at-bioperl-dot-org Lincoln Stein
lstein@cshl.org Jason Stajich jason@bioperl.org Sendu Bala
bix@sendu.me.uk
APPENDIX
The rest of the documentation details each of the object methods.
Internal methods are usually preceded with a _
new
Title : new
Usage : $o_usat =
Function: Builds a new Bio::Map::Microsatellite object
Returns : Bio::Map::Microsatellite
Args :
-name => name of this microsatellite (optional, string,
default 'Unknown microsatellite')
-positions => position(s) for this marker in maps[optional],
An array reference of tuples (array refs themselves)
Each tuple conatins a Bio::Map::MapI-inherited object and a
Bio::Map::PositionI-inherited obj, no default)
-sequence => the sequence of this microsatellite (optional,
scalar, no default)
-motif => the repeat motif of this microsatellite (optional,
scalar, no default)
-repeats => the number of motif repeats for this microsatellite
(optional, scalar, no default)
-repeat_start_position => the starting position of the
microsatellite in this sequence. The first base of the
sequence is position "1". (optional, scalar, no default)
Note : Creating a Bio::Map::Microsatellite object with no position
might be useful for microsatellite people wanting to embrace
and extend this module. <raising hand> Me! Me! Me!
- using repeat_start_position will trigger a mechinism to
calculate a value for repeat_end_position.
motif
Title : motif
Usage : $o_usat->motif($new_motif);
my $motif = $o_usat->motif();
Function: Get/Set the repeat motif for this Microsatellite.
Returns : A scalar representing the current repeat motif of this
Microsatellite.
Args : none to get, OR string to set
sequence
Title : sequence
Usage : $o_usat->sequence($new_sequence);
my $sequence = $o_usat->sequence();
Function: Get/Set the sequence for this Microsatellite.
Returns : A scalar representing the current sequence of this
Microsatellite.
Args : none to get, OR string to set
repeats
Title : repeats
Usage : $o_usat->repeats($new_repeats);
my $repeats = $o_usat->repeats()
Function: Get/Set the repeat repeats for this Microsatellite.
Returns : A scalar representing the current number of repeats of this
Microsatellite.
Args : none to get, OR int to set
repeat_start_position
Title : repeat_start_position
Usage : $o_usat->repeat_start_position($new_repeat_start_position);
my $repeat_start_position = $o_usat->repeat_start_position();
Function: Get/Set the repeat repeat_start_position for this
Microsatellite
Returns : A scalar representing the repeat start position for this
Microsatellite.
Args : none to get, OR string to set
This method will also try to set the repeat end position. This
depends on having information for the motif and the number of
repeats. If you want to use methods like get_trailing_flank or
get_leading flank, be careful to include the right information.
repeat_end_position
Title : repeat_end_position
Usage : $o_usat->repeat_end_position("set");
$o_usat->repeat_end_position($value);
$current_repeat_end_position = $o_usat->repeat_end_position();
Function: Get/set the end position of the repeat in this sequence.
Returns : A scalar representing the base index of the end of the
repeat in this Microsatellite. The first base in the sequence
is base 1.
Args : A scalar representing a value, the string "set", or no
argument (see Notes).
Notes : If you do not provide an argument to this method, the current
end position of the repeat in this Microsatellite will be
returned (a scalar).
If you provide the string "set" to this method it will set the
end position based on the start position, the length of the
motif, and the number of repeats.
If you specify a value the current end position of the repeat
will be set to that value. This is a really bad idea. Don't do
it.
equals
Title : equals
Usage : if ($mappable->equals($mapable2)) {...}
Function: Test if a position is equal to another position
Returns : boolean
Args : Bio::Map::MappableI
less_than
Title : less_than
Usage : if ($mappable->less_than($m2)) {...}
Function: Tests if a position is less than another position
Returns : boolean
Args : Bio::Map::MappableI
greater_than
Title : greater_than
Usage : if ($mappable->greater_than($m2)) {...}
Function: Tests if position is greater than another position
Returns : boolean
Args : Bio::Map::MappableI
get_leading_flank
Title : get_leading_flank
Usage : $leading_sequence = $o_usat->get_leading_flank();
Returns : A scalar representing the sequence before the repeats in this
Microsatellite.
Args : none
get_trailing_flank
Title : get_trailing_flank
Usage : $trailing_flank = $o_usat->get_trailing_flank();
Returns : A scalar representing the sequence after the repeats in this
Microsatellite.
Args : none
perl v5.14.1 2011-07-22 Bio::Map::Microsatellite(3)