PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)NAMEperlretut - Perl regular expressions tutorial
DESCRIPTION
This page provides a basic tutorial on understanding, creat-
ing and using regular expressions in Perl. It serves as a
complement to the reference page on regular expressions
perlre. Regular expressions are an integral part of the
"m//", "s///", "qr//" and "split" operators and so this
tutorial also overlaps with "Regexp Quote-Like Operators" in
perlop and "split" in perlfunc.
Perl is widely renowned for excellence in text processing,
and regular expressions are one of the big factors behind
this fame. Perl regular expressions display an efficiency
and flexibility unknown in most other computer languages.
Mastering even the basics of regular expressions will allow
you to manipulate text with surprising ease.
What is a regular expression? A regular expression is sim-
ply a string that describes a pattern. Patterns are in com-
mon use these days; examples are the patterns typed into a
search engine to find web pages and the patterns used to
list files in a directory, e.g., "ls *.txt" or "dir *.*".
In Perl, the patterns described by regular expressions are
used to search strings, extract desired parts of strings,
and to do search and replace operations.
Regular expressions have the undeserved reputation of being
abstract and difficult to understand. Regular expressions
are constructed using simple concepts like conditionals and
loops and are no more difficult to understand than the
corresponding "if" conditionals and "while" loops in the
Perl language itself. In fact, the main challenge in learn-
ing regular expressions is just getting used to the terse
notation used to express these concepts.
This tutorial flattens the learning curve by discussing reg-
ular expression concepts, along with their notation, one at
a time and with many examples. The first part of the
tutorial will progress from the simplest word searches to
the basic regular expression concepts. If you master the
first part, you will have all the tools needed to solve
about 98% of your needs. The second part of the tutorial is
for those comfortable with the basics and hungry for more
power tools. It discusses the more advanced regular expres-
sion operators and introduces the latest cutting edge inno-
vations in 5.6.0.
A note: to save time, 'regular expression' is often abbrevi-
ated as regexp or regex. Regexp is a more natural abbrevia-
tion than regex, but is harder to pronounce. The Perl pod
perl v5.8.8 2006-06-30 1
PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)
documentation is evenly split on regexp vs regex; in Perl,
there is more than one way to abbreviate it. We'll use
regexp in this tutorial.
Part 1: The basics
Simple word matching
The simplest regexp is simply a word, or more generally, a
string of characters. A regexp consisting of a word matches
any string that contains that word:
"Hello World" =~ /World/; # matches
What is this perl statement all about? "Hello World" is a
simple double quoted string. "World" is the regular expres-
sion and the "//" enclosing "/World/" tells perl to search a
string for a match. The operator "=~" associates the string
with the regexp match and produces a true value if the
regexp matched, or false if the regexp did not match. In
our case, "World" matches the second word in "Hello World",
so the expression is true. Expressions like this are useful
in conditionals:
if ("Hello World" =~ /World/) {
print "It matches\n";
}
else {
print "It doesn't match\n";
}
There are useful variations on this theme. The sense of the
match can be reversed by using "!~" operator:
if ("Hello World" !~ /World/) {
print "It doesn't match\n";
}
else {
print "It matches\n";
}
The literal string in the regexp can be replaced by a vari-
able:
$greeting = "World";
if ("Hello World" =~ /$greeting/) {
print "It matches\n";
}
else {
print "It doesn't match\n";
}
perl v5.8.8 2006-06-30 2
PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)
If you're matching against the special default variable $_,
the "$_ =~" part can be omitted:
$_ = "Hello World";
if (/World/) {
print "It matches\n";
}
else {
print "It doesn't match\n";
}
And finally, the "//" default delimiters for a match can be
changed to arbitrary delimiters by putting an 'm' out front:
"Hello World" =~ m!World!; # matches, delimited by '!'
"Hello World" =~ m{World}; # matches, note the matching '{}'
"/usr/bin/perl" =~ m"/perl"; # matches after '/usr/bin',
# '/' becomes an ordinary char
"/World/", "m!World!", and "m{World}" all represent the same
thing. When, e.g., "" is used as a delimiter, the forward
slash '/' becomes an ordinary character and can be used in a
regexp without trouble.
Let's consider how different regexps would match "Hello
World":
"Hello World" =~ /world/; # doesn't match
"Hello World" =~ /o W/; # matches
"Hello World" =~ /oW/; # doesn't match
"Hello World" =~ /World /; # doesn't match
The first regexp "world" doesn't match because regexps are
case-sensitive. The second regexp matches because the sub-
string 'o W' occurs in the string "Hello World" . The
space character ' ' is treated like any other character in a
regexp and is needed to match in this case. The lack of a
space character is the reason the third regexp 'oW' doesn't
match. The fourth regexp 'World ' doesn't match because
there is a space at the end of the regexp, but not at the
end of the string. The lesson here is that regexps must
match a part of the string exactly in order for the state-
ment to be true.
If a regexp matches in more than one place in the string,
perl will always match at the earliest possible point in the
string:
"Hello World" =~ /o/; # matches 'o' in 'Hello'
"That hat is red" =~ /hat/; # matches 'hat' in 'That'
perl v5.8.8 2006-06-30 3
PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)
With respect to character matching, there are a few more
points you need to know about. First of all, not all char-
acters can be used 'as is' in a match. Some characters,
called metacharacters, are reserved for use in regexp nota-
tion. The metacharacters are
{}[]()^$.|*+?\
The significance of each of these will be explained in the
rest of the tutorial, but for now, it is important only to
know that a metacharacter can be matched by putting a
backslash before it:
"2+2=4" =~ /2+2/; # doesn't match, + is a metacharacter
"2+2=4" =~ /2\+2/; # matches, \+ is treated like an ordinary +
"The interval is [0,1)." =~ /[0,1)./ # is a syntax error!
"The interval is [0,1)." =~ /\[0,1\)\./ # matches
"/usr/bin/perl" =~ /\/usr\/bin\/perl/; # matches
In the last regexp, the forward slash '/' is also
backslashed, because it is used to delimit the regexp. This
can lead to LTS (leaning toothpick syndrome), however, and
it is often more readable to change delimiters.
"/usr/bin/perl" =~ m!/usr/bin/perl!; # easier to read
The backslash character '\' is a metacharacter itself and
needs to be backslashed:
'C:\WIN32' =~ /C:\\WIN/; # matches
In addition to the metacharacters, there are some ASCII
characters which don't have printable character equivalents
and are instead represented by escape sequences. Common
examples are "\t" for a tab, "\n" for a newline, "\r" for a
carriage return and "\a" for a bell. If your string is
better thought of as a sequence of arbitrary bytes, the
octal escape sequence, e.g., "\033", or hexadecimal escape
sequence, e.g., "\x1B" may be a more natural representation
for your bytes. Here are some examples of escapes:
"1000\t2000" =~ m(0\t2) # matches
"1000\n2000" =~ /0\n20/ # matches
"1000\t2000" =~ /\000\t2/ # doesn't match, "0" ne "\000"
"cat" =~ /\143\x61\x74/ # matches, but a weird way to spell cat
If you've been around Perl a while, all this talk of escape
sequences may seem familiar. Similar escape sequences are
used in double-quoted strings and in fact the regexps in
Perl are mostly treated as double-quoted strings. This
means that variables can be used in regexps as well. Just
like double-quoted strings, the values of the variables in
perl v5.8.8 2006-06-30 4
PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)
the regexp will be substituted in before the regexp is
evaluated for matching purposes. So we have:
$foo = 'house';
'housecat' =~ /$foo/; # matches
'cathouse' =~ /cat$foo/; # matches
'housecat' =~ /${foo}cat/; # matches
So far, so good. With the knowledge above you can already
perform searches with just about any literal string regexp
you can dream up. Here is a very simple emulation of the
Unix grep program:
% cat > simple_grep
#!/usr/bin/perl
$regexp = shift;
while (<>) {
print if /$regexp/;
}
^D
% chmod +x simple_grep
% simple_grep abba /usr/dict/words
Babbage
cabbage
cabbages
sabbath
Sabbathize
Sabbathizes
sabbatical
scabbard
scabbards
This program is easy to understand. "#!/usr/bin/perl" is
the standard way to invoke a perl program from the shell.
"$regexp = shift;" saves the first command line argument as
the regexp to be used, leaving the rest of the command line
arguments to be treated as files. "while (<>)" loops over
all the lines in all the files. For each line,
"print if /$regexp/;" prints the line if the regexp matches
the line. In this line, both "print" and "/$regexp/" use
the default variable $_ implicitly.
With all of the regexps above, if the regexp matched any-
where in the string, it was considered a match. Sometimes,
however, we'd like to specify where in the string the regexp
should try to match. To do this, we would use the anchor
metacharacters "^" and "$". The anchor "^" means match at
the beginning of the string and the anchor "$" means match
at the end of the string, or before a newline at the end of
the string. Here is how they are used:
perl v5.8.8 2006-06-30 5
PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)
"housekeeper" =~ /keeper/; # matches
"housekeeper" =~ /^keeper/; # doesn't match
"housekeeper" =~ /keeper$/; # matches
"housekeeper\n" =~ /keeper$/; # matches
The second regexp doesn't match because "^" constrains
"keeper" to match only at the beginning of the string, but
"housekeeper" has keeper starting in the middle. The third
regexp does match, since the "$" constrains "keeper" to
match only at the end of the string.
When both "^" and "$" are used at the same time, the regexp
has to match both the beginning and the end of the string,
i.e., the regexp matches the whole string. Consider
"keeper" =~ /^keep$/; # doesn't match
"keeper" =~ /^keeper$/; # matches
"" =~ /^$/; # ^$ matches an empty string
The first regexp doesn't match because the string has more
to it than "keep". Since the second regexp is exactly the
string, it matches. Using both "^" and "$" in a regexp
forces the complete string to match, so it gives you com-
plete control over which strings match and which don't.
Suppose you are looking for a fellow named bert, off in a
string by himself:
"dogbert" =~ /bert/; # matches, but not what you want
"dilbert" =~ /^bert/; # doesn't match, but ..
"bertram" =~ /^bert/; # matches, so still not good enough
"bertram" =~ /^bert$/; # doesn't match, good
"dilbert" =~ /^bert$/; # doesn't match, good
"bert" =~ /^bert$/; # matches, perfect
Of course, in the case of a literal string, one could just
as easily use the string equivalence "$string eq 'bert'"
and it would be more efficient. The "^...$" regexp really
becomes useful when we add in the more powerful regexp tools
below.
Using character classes
Although one can already do quite a lot with the literal
string regexps above, we've only scratched the surface of
regular expression technology. In this and subsequent sec-
tions we will introduce regexp concepts (and associated
metacharacter notations) that will allow a regexp to not
just represent a single character sequence, but a whole
class of them.
perl v5.8.8 2006-06-30 6
PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)
One such concept is that of a character class. A character
class allows a set of possible characters, rather than just
a single character, to match at a particular point in a
regexp. Character classes are denoted by brackets "[...]",
with the set of characters to be possibly matched inside.
Here are some examples:
/cat/; # matches 'cat'
/[bcr]at/; # matches 'bat, 'cat', or 'rat'
/item[0123456789]/; # matches 'item0' or ... or 'item9'
"abc" =~ /[cab]/; # matches 'a'
In the last statement, even though 'c' is the first charac-
ter in the class, 'a' matches because the first character
position in the string is the earliest point at which the
regexp can match.
/[yY][eE][sS]/; # match 'yes' in a case-insensitive way
# 'yes', 'Yes', 'YES', etc.
This regexp displays a common task: perform a case-
insensitive match. Perl provides away of avoiding all those
brackets by simply appending an 'i' to the end of the match.
Then "/[yY][eE][sS]/;" can be rewritten as "/yes/i;". The
'i' stands for case-insensitive and is an example of a
modifier of the matching operation. We will meet other
modifiers later in the tutorial.
We saw in the section above that there were ordinary charac-
ters, which represented themselves, and special characters,
which needed a backslash "\" to represent themselves. The
same is true in a character class, but the sets of ordinary
and special characters inside a character class are dif-
ferent than those outside a character class. The special
characters for a character class are "-]\^$". "]" is spe-
cial because it denotes the end of a character class. "$"
is special because it denotes a scalar variable. "\" is
special because it is used in escape sequences, just like
above. Here is how the special characters "]$\" are han-
dled:
/[\]c]def/; # matches ']def' or 'cdef'
$x = 'bcr';
/[$x]at/; # matches 'bat', 'cat', or 'rat'
/[\$x]at/; # matches '$at' or 'xat'
/[\\$x]at/; # matches '\at', 'bat, 'cat', or 'rat'
The last two are a little tricky. in "[\$x]", the backslash
protects the dollar sign, so the character class has two
members "$" and "x". In "[\\$x]", the backslash is pro-
tected, so $x is treated as a variable and substituted in
double quote fashion.
perl v5.8.8 2006-06-30 7
PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)
The special character '-' acts as a range operator within
character classes, so that a contiguous set of characters
can be written as a range. With ranges, the unwieldy
"[0123456789]" and "[abc...xyz]" become the svelte "[0-9]"
and "[a-z]". Some examples are
/item[0-9]/; # matches 'item0' or ... or 'item9'
/[0-9bx-z]aa/; # matches '0aa', ..., '9aa',
# 'baa', 'xaa', 'yaa', or 'zaa'
/[0-9a-fA-F]/; # matches a hexadecimal digit
/[0-9a-zA-Z_]/; # matches a "word" character,
# like those in a perl variable name
If '-' is the first or last character in a character class,
it is treated as an ordinary character; "[-ab]", "[ab-]" and
"[a\-b]" are all equivalent.
The special character "^" in the first position of a charac-
ter class denotes a negated character class, which matches
any character but those in the brackets. Both "[...]" and
"[^...]" must match a character, or the match fails. Then
/[^a]at/; # doesn't match 'aat' or 'at', but matches
# all other 'bat', 'cat, '0at', '%at', etc.
/[^0-9]/; # matches a non-numeric character
/[a^]at/; # matches 'aat' or '^at'; here '^' is ordinary
Now, even "[0-9]" can be a bother the write multiple times,
so in the interest of saving keystrokes and making regexps
more readable, Perl has several abbreviations for common
character classes:
+ \d is a digit and represents [0-9]
+ \s is a whitespace character and represents [\ \t\r\n\f]
+ \w is a word character (alphanumeric or _) and
represents [0-9a-zA-Z_]
+ \D is a negated \d; it represents any character but a
digit [^0-9]
+ \S is a negated \s; it represents any non-whitespace
character [^\s]
+ \W is a negated \w; it represents any non-word character
[^\w]
+ The period '.' matches any character but "\n"
The "\d\s\w\D\S\W" abbreviations can be used both inside and
outside of character classes. Here are some in use:
perl v5.8.8 2006-06-30 8
PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)
/\d\d:\d\d:\d\d/; # matches a hh:mm:ss time format
/[\d\s]/; # matches any digit or whitespace character
/\w\W\w/; # matches a word char, followed by a
# non-word char, followed by a word char
/..rt/; # matches any two chars, followed by 'rt'
/end\./; # matches 'end.'
/end[.]/; # same thing, matches 'end.'
Because a period is a metacharacter, it needs to be escaped
to match as an ordinary period. Because, for example, "\d"
and "\w" are sets of characters, it is incorrect to think of
"[^\d\w]" as "[\D\W]"; in fact "[^\d\w]" is the same as
"[^\w]", which is the same as "[\W]". Think DeMorgan's laws.
An anchor useful in basic regexps is the word anchor "\b".
This matches a boundary between a word character and a non-
word character "\w\W" or "\W\w":
$x = "Housecat catenates house and cat";
$x =~ /cat/; # matches cat in 'housecat'
$x =~ /\bcat/; # matches cat in 'catenates'
$x =~ /cat\b/; # matches cat in 'housecat'
$x =~ /\bcat\b/; # matches 'cat' at end of string
Note in the last example, the end of the string is con-
sidered a word boundary.
You might wonder why '.' matches everything but "\n" - why
not every character? The reason is that often one is match-
ing against lines and would like to ignore the newline char-
acters. For instance, while the string "\n" represents one
line, we would like to think of as empty. Then
"" =~ /^$/; # matches
"\n" =~ /^$/; # matches, "\n" is ignored
"" =~ /./; # doesn't match; it needs a char
"" =~ /^.$/; # doesn't match; it needs a char
"\n" =~ /^.$/; # doesn't match; it needs a char other than "\n"
"a" =~ /^.$/; # matches
"a\n" =~ /^.$/; # matches, ignores the "\n"
This behavior is convenient, because we usually want to
ignore newlines when we count and match characters in a
line. Sometimes, however, we want to keep track of new-
lines. We might even want "^" and "$" to anchor at the
beginning and end of lines within the string, rather than
just the beginning and end of the string. Perl allows us to
choose between ignoring and paying attention to newlines by
using the "//s" and "//m" modifiers. "//s" and "//m" stand
for single line and multi-line and they determine whether a
string is to be treated as one continuous string, or as a
perl v5.8.8 2006-06-30 9
PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)
set of lines. The two modifiers affect two aspects of how
the regexp is interpreted: 1) how the '.' character class is
defined, and 2) where the anchors "^" and "$" are able to
match. Here are the four possible combinations:
+ no modifiers (//): Default behavior. '.' matches any
character except "\n". "^" matches only at the begin-
ning of the string and "$" matches only at the end or
before a newline at the end.
+ s modifier (//s): Treat string as a single long line.
'.' matches any character, even "\n". "^" matches only
at the beginning of the string and "$" matches only at
the end or before a newline at the end.
+ m modifier (//m): Treat string as a set of multiple
lines. '.' matches any character except "\n". "^" and
"$" are able to match at the start or end of any line
within the string.
+ both s and m modifiers (//sm): Treat string as a single
long line, but detect multiple lines. '.' matches any
character, even "\n". "^" and "$", however, are able to
match at the start or end of any line within the string.
Here are examples of "//s" and "//m" in action:
$x = "There once was a girl\nWho programmed in Perl\n";
$x =~ /^Who/; # doesn't match, "Who" not at start of string
$x =~ /^Who/s; # doesn't match, "Who" not at start of string
$x =~ /^Who/m; # matches, "Who" at start of second line
$x =~ /^Who/sm; # matches, "Who" at start of second line
$x =~ /girl.Who/; # doesn't match, "." doesn't match "\n"
$x =~ /girl.Who/s; # matches, "." matches "\n"
$x =~ /girl.Who/m; # doesn't match, "." doesn't match "\n"
$x =~ /girl.Who/sm; # matches, "." matches "\n"
Most of the time, the default behavior is what is want, but
"//s" and "//m" are occasionally very useful. If "//m" is
being used, the start of the string can still be matched
with "\A" and the end of string can still be matched with
the anchors "\Z" (matches both the end and the newline
before, like "$"), and "\z" (matches only the end):
$x =~ /^Who/m; # matches, "Who" at start of second line
$x =~ /\AWho/m; # doesn't match, "Who" is not at start of string
$x =~ /girl$/m; # matches, "girl" at end of first line
$x =~ /girl\Z/m; # doesn't match, "girl" is not at end of string
perl v5.8.8 2006-06-30 10
PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)
$x =~ /Perl\Z/m; # matches, "Perl" is at newline before end
$x =~ /Perl\z/m; # doesn't match, "Perl" is not at end of string
We now know how to create choices among classes of charac-
ters in a regexp. What about choices among words or charac-
ter strings? Such choices are described in the next section.
Matching this or that
Sometimes we would like to our regexp to be able to match
different possible words or character strings. This is
accomplished by using the alternation metacharacter "|". To
match "dog" or "cat", we form the regexp "dog|cat". As
before, perl will try to match the regexp at the earliest
possible point in the string. At each character position,
perl will first try to match the first alternative, "dog".
If "dog" doesn't match, perl will then try the next alterna-
tive, "cat". If "cat" doesn't match either, then the match
fails and perl moves to the next position in the string.
Some examples:
"cats and dogs" =~ /cat|dog|bird/; # matches "cat"
"cats and dogs" =~ /dog|cat|bird/; # matches "cat"
Even though "dog" is the first alternative in the second
regexp, "cat" is able to match earlier in the string.
"cats" =~ /c|ca|cat|cats/; # matches "c"
"cats" =~ /cats|cat|ca|c/; # matches "cats"
Here, all the alternatives match at the first string posi-
tion, so the first alternative is the one that matches. If
some of the alternatives are truncations of the others, put
the longest ones first to give them a chance to match.
"cab" =~ /a|b|c/ # matches "c"
# /a|b|c/ == /[abc]/
The last example points out that character classes are like
alternations of characters. At a given character position,
the first alternative that allows the regexp match to
succeed will be the one that matches.
Grouping things and hierarchical matching
Alternation allows a regexp to choose among alternatives,
but by itself it unsatisfying. The reason is that each
alternative is a whole regexp, but sometime we want alterna-
tives for just part of a regexp. For instance, suppose we
want to search for housecats or housekeepers. The regexp
"housecat|housekeeper" fits the bill, but is inefficient
because we had to type "house" twice. It would be nice to
perl v5.8.8 2006-06-30 11
PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)
have parts of the regexp be constant, like "house", and some
parts have alternatives, like "cat|keeper".
The grouping metacharacters "()" solve this problem. Group-
ing allows parts of a regexp to be treated as a single unit.
Parts of a regexp are grouped by enclosing them in
parentheses. Thus we could solve the "housecat|housekeeper"
by forming the regexp as "house(cat|keeper)". The regexp
"house(cat|keeper)" means match "house" followed by either
"cat" or "keeper". Some more examples are
/(a|b)b/; # matches 'ab' or 'bb'
/(ac|b)b/; # matches 'acb' or 'bb'
/(^a|b)c/; # matches 'ac' at start of string or 'bc' anywhere
/(a|[bc])d/; # matches 'ad', 'bd', or 'cd'
/house(cat|)/; # matches either 'housecat' or 'house'
/house(cat(s|)|)/; # matches either 'housecats' or 'housecat' or
# 'house'. Note groups can be nested.
/(19|20|)\d\d/; # match years 19xx, 20xx, or the Y2K problem, xx
"20" =~ /(19|20|)\d\d/; # matches the null alternative '()\d\d',
# because '20\d\d' can't match
Alternations behave the same way in groups as out of them:
at a given string position, the leftmost alternative that
allows the regexp to match is taken. So in the last example
at the first string position, "20" matches the second alter-
native, but there is nothing left over to match the next two
digits "\d\d". So perl moves on to the next alternative,
which is the null alternative and that works, since "20" is
two digits.
The process of trying one alternative, seeing if it matches,
and moving on to the next alternative if it doesn't, is
called backtracking. The term 'backtracking' comes from the
idea that matching a regexp is like a walk in the woods.
Successfully matching a regexp is like arriving at a desti-
nation. There are many possible trailheads, one for each
string position, and each one is tried in order, left to
right. From each trailhead there may be many paths, some of
which get you there, and some which are dead ends. When you
walk along a trail and hit a dead end, you have to backtrack
along the trail to an earlier point to try another trail.
If you hit your destination, you stop immediately and forget
about trying all the other trails. You are persistent, and
only if you have tried all the trails from all the trail-
heads and not arrived at your destination, do you declare
failure. To be concrete, here is a step-by-step analysis of
what perl does when it tries to match the regexp
perl v5.8.8 2006-06-30 12
PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)
"abcde" =~ /(abd|abc)(df|d|de)/;
0 Start with the first letter in the string 'a'.
1 Try the first alternative in the first group 'abd'.
2 Match 'a' followed by 'b'. So far so good.
3 'd' in the regexp doesn't match 'c' in the string - a
dead end. So backtrack two characters and pick the
second alternative in the first group 'abc'.
4 Match 'a' followed by 'b' followed by 'c'. We are on a
roll and have satisfied the first group. Set $1 to
'abc'.
5 Move on to the second group and pick the first alterna-
tive 'df'.
6 Match the 'd'.
7 'f' in the regexp doesn't match 'e' in the string, so a
dead end. Backtrack one character and pick the second
alternative in the second group 'd'.
8 'd' matches. The second grouping is satisfied, so set $2
to 'd'.
9 We are at the end of the regexp, so we are done! We have
matched 'abcd' out of the string "abcde".
There are a couple of things to note about this analysis.
First, the third alternative in the second group 'de' also
allows a match, but we stopped before we got to it - at a
given character position, leftmost wins. Second, we were
able to get a match at the first character position of the
string 'a'. If there were no matches at the first position,
perl would move to the second character position 'b' and
attempt the match all over again. Only when all possible
paths at all possible character positions have been
exhausted does perl give up and declare
"$string =~ /(abd|abc)(df|d|de)/;" to be false.
Even with all this work, regexp matching happens remarkably
fast. To speed things up, during compilation stage, perl
compiles the regexp into a compact sequence of opcodes that
can often fit inside a processor cache. When the code is
executed, these opcodes can then run at full throttle and
search very quickly.
perl v5.8.8 2006-06-30 13
PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)
Extracting matches
The grouping metacharacters "()" also serve another com-
pletely different function: they allow the extraction of the
parts of a string that matched. This is very useful to find
out what matched and for text processing in general. For
each grouping, the part that matched inside goes into the
special variables $1, $2, etc. They can be used just as
ordinary variables:
# extract hours, minutes, seconds
if ($time =~ /(\d\d):(\d\d):(\d\d)/) { # match hh:mm:ss format
$hours = $1;
$minutes = $2;
$seconds = $3;
}
Now, we know that in scalar context,
"$time =~ /(\d\d):(\d\d):(\d\d)/" returns a true or false
value. In list context, however, it returns the list of
matched values "($1,$2,$3)". So we could write the code
more compactly as
# extract hours, minutes, seconds
($hours, $minutes, $second) = ($time =~ /(\d\d):(\d\d):(\d\d)/);
If the groupings in a regexp are nested, $1 gets the group
with the leftmost opening parenthesis, $2 the next opening
parenthesis, etc. For example, here is a complex regexp and
the matching variables indicated below it:
/(ab(cd|ef)((gi)|j))/;
1 2 34
so that if the regexp matched, e.g., $2 would contain 'cd'
or 'ef'. For convenience, perl sets $+ to the string held by
the highest numbered $1, $2, ... that got assigned (and,
somewhat related, $^N to the value of the $1, $2, ... most-
recently assigned; i.e. the $1, $2, ... associated with the
rightmost closing parenthesis used in the match).
Closely associated with the matching variables $1, $2, ...
are the backreferences "\1", "\2", ... . Backreferences are
simply matching variables that can be used inside a regexp.
This is a really nice feature - what matches later in a
regexp can depend on what matched earlier in the regexp.
Suppose we wanted to look for doubled words in text, like
'the the'. The following regexp finds all 3-letter doubles
with a space in between:
/(\w\w\w)\s\1/;
perl v5.8.8 2006-06-30 14
PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)
The grouping assigns a value to \1, so that the same 3
letter sequence is used for both parts. Here are some words
with repeated parts:
% simple_grep '^(\w\w\w\w|\w\w\w|\w\w|\w)\1$' /usr/dict/words
beriberi
booboo
coco
mama
murmur
papa
The regexp has a single grouping which considers 4-letter
combinations, then 3-letter combinations, etc. and uses
"\1" to look for a repeat. Although $1 and "\1" represent
the same thing, care should be taken to use matched vari-
ables $1, $2, ... only outside a regexp and backreferences
"\1", "\2", ... only inside a regexp; not doing so may lead
to surprising and/or undefined results.
In addition to what was matched, Perl 5.6.0 also provides
the positions of what was matched with the "@-" and "@+"
arrays. "$-[0]" is the position of the start of the entire
match and $+[0] is the position of the end. Similarly,
"$-[n]" is the position of the start of the $n match and
$+[n] is the position of the end. If $n is undefined, so are
"$-[n]" and $+[n]. Then this code
$x = "Mmm...donut, thought Homer";
$x =~ /^(Mmm|Yech)\.\.\.(donut|peas)/; # matches
foreach $expr (1..$#-) {
print "Match $expr: '${$expr}' at position ($-[$expr],$+[$expr])\n";
}
prints
Match 1: 'Mmm' at position (0,3)
Match 2: 'donut' at position (6,11)
Even if there are no groupings in a regexp, it is still pos-
sible to find out what exactly matched in a string. If you
use them, perl will set $` to the part of the string before
the match, will set $& to the part of the string that
matched, and will set $' to the part of the string after the
match. An example:
$x = "the cat caught the mouse";
$x =~ /cat/; # $` = 'the ', $& = 'cat', $' = ' caught the mouse'
$x =~ /the/; # $` = '', $& = 'the', $' = ' cat caught the mouse'
In the second match, "$` = ''" because the regexp matched
at the first character position in the string and stopped,
perl v5.8.8 2006-06-30 15
PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)
it never saw the second 'the'. It is important to note that
using $` and $' slows down regexp matching quite a bit, and
$& slows it down to a lesser extent, because if they are
used in one regexp in a program, they are generated for
<all> regexps in the program. So if raw performance is a
goal of your application, they should be avoided. If you
need them, use "@-" and "@+" instead:
$` is the same as substr( $x, 0, $-[0] )
$& is the same as substr( $x, $-[0], $+[0]-$-[0] )
$' is the same as substr( $x, $+[0] )
Matching repetitions
The examples in the previous section display an annoying
weakness. We were only matching 3-letter words, or syll-
ables of 4 letters or less. We'd like to be able to match
words or syllables of any length, without writing out tedi-
ous alternatives like "\w\w\w\w|\w\w\w|\w\w|\w".
This is exactly the problem the quantifier metacharacters
"?", "*", "+", and "{}" were created for. They allow us to
determine the number of repeats of a portion of a regexp we
consider to be a match. Quantifiers are put immediately
after the character, character class, or grouping that we
want to specify. They have the following meanings:
+ "a?" = match 'a' 1 or 0 times
+ "a*" = match 'a' 0 or more times, i.e., any number of
times
+ "a+" = match 'a' 1 or more times, i.e., at least once
+ "a{n,m}" = match at least "n" times, but not more than
"m" times.
+ "a{n,}" = match at least "n" or more times
+ "a{n}" = match exactly "n" times
Here are some examples:
/[a-z]+\s+\d*/; # match a lowercase word, at least some space, and
# any number of digits
/(\w+)\s+\1/; # match doubled words of arbitrary length
/y(es)?/i; # matches 'y', 'Y', or a case-insensitive 'yes'
$year =~ /\d{2,4}/; # make sure year is at least 2 but not more
# than 4 digits
$year =~ /\d{4}|\d{2}/; # better match; throw out 3 digit dates
$year =~ /\d{2}(\d{2})?/; # same thing written differently. However,
# this produces $1 and the other does not.
perl v5.8.8 2006-06-30 16
PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)
% simple_grep '^(\w+)\1$' /usr/dict/words # isn't this easier?
beriberi
booboo
coco
mama
murmur
papa
For all of these quantifiers, perl will try to match as much
of the string as possible, while still allowing the regexp
to succeed. Thus with "/a?.../", perl will first try to
match the regexp with the "a" present; if that fails, perl
will try to match the regexp without the "a" present. For
the quantifier "*", we get the following:
$x = "the cat in the hat";
$x =~ /^(.*)(cat)(.*)$/; # matches,
# $1 = 'the '
# $2 = 'cat'
# $3 = ' in the hat'
Which is what we might expect, the match finds the only
"cat" in the string and locks onto it. Consider, however,
this regexp:
$x =~ /^(.*)(at)(.*)$/; # matches,
# $1 = 'the cat in the h'
# $2 = 'at'
# $3 = '' (0 matches)
One might initially guess that perl would find the "at" in
"cat" and stop there, but that wouldn't give the longest
possible string to the first quantifier ".*". Instead, the
first quantifier ".*" grabs as much of the string as possi-
ble while still having the regexp match. In this example,
that means having the "at" sequence with the final "at" in
the string. The other important principle illustrated here
is that when there are two or more elements in a regexp, the
leftmost quantifier, if there is one, gets to grab as much
the string as possible, leaving the rest of the regexp to
fight over scraps. Thus in our example, the first quantif-
ier ".*" grabs most of the string, while the second quantif-
ier ".*" gets the empty string. Quantifiers that grab as
much of the string as possible are called maximal match or
greedy quantifiers.
When a regexp can match a string in several different ways,
we can use the principles above to predict which way the
regexp will match:
+ Principle 0: Taken as a whole, any regexp will be
matched at the earliest possible position in the string.
perl v5.8.8 2006-06-30 17
PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)
+ Principle 1: In an alternation "a|b|c...", the leftmost
alternative that allows a match for the whole regexp
will be the one used.
+ Principle 2: The maximal matching quantifiers "?", "*",
"+" and "{n,m}" will in general match as much of the
string as possible while still allowing the whole regexp
to match.
+ Principle 3: If there are two or more elements in a
regexp, the leftmost greedy quantifier, if any, will
match as much of the string as possible while still
allowing the whole regexp to match. The next leftmost
greedy quantifier, if any, will try to match as much of
the string remaining available to it as possible, while
still allowing the whole regexp to match. And so on,
until all the regexp elements are satisfied.
As we have seen above, Principle 0 overrides the others -
the regexp will be matched as early as possible, with the
other principles determining how the regexp matches at that
earliest character position.
Here is an example of these principles in action:
$x = "The programming republic of Perl";
$x =~ /^(.+)(e|r)(.*)$/; # matches,
# $1 = 'The programming republic of Pe'
# $2 = 'r'
# $3 = 'l'
This regexp matches at the earliest string position, 'T'.
One might think that "e", being leftmost in the alternation,
would be matched, but "r" produces the longest string in the
first quantifier.
$x =~ /(m{1,2})(.*)$/; # matches,
# $1 = 'mm'
# $2 = 'ing republic of Perl'
Here, The earliest possible match is at the first 'm' in
"programming". "m{1,2}" is the first quantifier, so it gets
to match a maximal "mm".
$x =~ /.*(m{1,2})(.*)$/; # matches,
# $1 = 'm'
# $2 = 'ing republic of Perl'
Here, the regexp matches at the start of the string. The
first quantifier ".*" grabs as much as possible, leaving
just a single 'm' for the second quantifier "m{1,2}".
perl v5.8.8 2006-06-30 18
PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)
$x =~ /(.?)(m{1,2})(.*)$/; # matches,
# $1 = 'a'
# $2 = 'mm'
# $3 = 'ing republic of Perl'
Here, ".?" eats its maximal one character at the earliest
possible position in the string, 'a' in "programming", leav-
ing "m{1,2}" the opportunity to match both "m"'s. Finally,
"aXXXb" =~ /(X*)/; # matches with $1 = ''
because it can match zero copies of 'X' at the beginning of
the string. If you definitely want to match at least one
'X', use "X+", not "X*".
Sometimes greed is not good. At times, we would like quan-
tifiers to match a minimal piece of string, rather than a
maximal piece. For this purpose, Larry Wall created the
minimal match or non-greedy quantifiers "??","*?", "+?",
and "{}?". These are the usual quantifiers with a "?"
appended to them. They have the following meanings:
+ "a??" = match 'a' 0 or 1 times. Try 0 first, then 1.
+ "a*?" = match 'a' 0 or more times, i.e., any number of
times, but as few times as possible
+ "a+?" = match 'a' 1 or more times, i.e., at least once,
but as few times as possible
+ "a{n,m}?" = match at least "n" times, not more than "m"
times, as few times as possible
+ "a{n,}?" = match at least "n" times, but as few times as
possible
+ "a{n}?" = match exactly "n" times. Because we match
exactly "n" times, "a{n}?" is equivalent to "a{n}" and
is just there for notational consistency.
Let's look at the example above, but with minimal quantif-
iers:
$x = "The programming republic of Perl";
$x =~ /^(.+?)(e|r)(.*)$/; # matches,
# $1 = 'Th'
# $2 = 'e'
# $3 = ' programming republic of Perl'
The minimal string that will allow both the start of the
string "^" and the alternation to match is "Th", with the
alternation "e|r" matching "e". The second quantifier ".*"
perl v5.8.8 2006-06-30 19
PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)
is free to gobble up the rest of the string.
$x =~ /(m{1,2}?)(.*?)$/; # matches,
# $1 = 'm'
# $2 = 'ming republic of Perl'
The first string position that this regexp can match is at
the first 'm' in "programming". At this position, the
minimal "m{1,2}?" matches just one 'm'. Although the second
quantifier ".*?" would prefer to match no characters, it is
constrained by the end-of-string anchor "$" to match the
rest of the string.
$x =~ /(.*?)(m{1,2}?)(.*)$/; # matches,
# $1 = 'The progra'
# $2 = 'm'
# $3 = 'ming republic of Perl'
In this regexp, you might expect the first minimal quantif-
ier ".*?" to match the empty string, because it is not con-
strained by a "^" anchor to match the beginning of the word.
Principle 0 applies here, however. Because it is possible
for the whole regexp to match at the start of the string, it
will match at the start of the string. Thus the first quan-
tifier has to match everything up to the first "m". The
second minimal quantifier matches just one "m" and the third
quantifier matches the rest of the string.
$x =~ /(.??)(m{1,2})(.*)$/; # matches,
# $1 = 'a'
# $2 = 'mm'
# $3 = 'ing republic of Perl'
Just as in the previous regexp, the first quantifier ".??"
can match earliest at position 'a', so it does. The second
quantifier is greedy, so it matches "mm", and the third
matches the rest of the string.
We can modify principle 3 above to take into account non-
greedy quantifiers:
+ Principle 3: If there are two or more elements in a
regexp, the leftmost greedy (non-greedy) quantifier, if
any, will match as much (little) of the string as possi-
ble while still allowing the whole regexp to match. The
next leftmost greedy (non-greedy) quantifier, if any,
will try to match as much (little) of the string remain-
ing available to it as possible, while still allowing
the whole regexp to match. And so on, until all the
regexp elements are satisfied.
perl v5.8.8 2006-06-30 20
PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)
Just like alternation, quantifiers are also susceptible to
backtracking. Here is a step-by-step analysis of the exam-
ple
$x = "the cat in the hat";
$x =~ /^(.*)(at)(.*)$/; # matches,
# $1 = 'the cat in the h'
# $2 = 'at'
# $3 = '' (0 matches)
0 Start with the first letter in the string 't'.
1 The first quantifier '.*' starts out by matching the
whole string 'the cat in the hat'.
2 'a' in the regexp element 'at' doesn't match the end of
the string. Backtrack one character.
3 'a' in the regexp element 'at' still doesn't match the
last letter of the string 't', so backtrack one more
character.
4 Now we can match the 'a' and the 't'.
5 Move on to the third element '.*'. Since we are at the
end of the string and '.*' can match 0 times, assign it
the empty string.
6 We are done!
Most of the time, all this moving forward and backtracking
happens quickly and searching is fast. There are some
pathological regexps, however, whose execution time exponen-
tially grows with the size of the string. A typical struc-
ture that blows up in your face is of the form
/(a|b+)*/;
The problem is the nested indeterminate quantifiers. There
are many different ways of partitioning a string of length n
between the "+" and "*": one repetition with "b+" of length
n, two repetitions with the first "b+" length k and the
second with length n-k, m repetitions whose bits add up to
length n, etc. In fact there are an exponential number of
ways to partition a string as a function of length. A
regexp may get lucky and match early in the process, but if
there is no match, perl will try every possibility before
giving up. So be careful with nested "*"'s, "{n,m}"'s, and
"+"'s. The book Mastering regular expressions by Jeffrey
Friedl gives a wonderful discussion of this and other effi-
ciency issues.
perl v5.8.8 2006-06-30 21
PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)
Building a regexp
At this point, we have all the basic regexp concepts
covered, so let's give a more involved example of a regular
expression. We will build a regexp that matches numbers.
The first task in building a regexp is to decide what we
want to match and what we want to exclude. In our case, we
want to match both integers and floating point numbers and
we want to reject any string that isn't a number.
The next task is to break the problem down into smaller
problems that are easily converted into a regexp.
The simplest case is integers. These consist of a sequence
of digits, with an optional sign in front. The digits we
can represent with "\d+" and the sign can be matched with
"[+-]". Thus the integer regexp is
/[+-]?\d+/; # matches integers
A floating point number potentially has a sign, an integral
part, a decimal point, a fractional part, and an exponent.
One or more of these parts is optional, so we need to check
out the different possibilities. Floating point numbers
which are in proper form include 123., 0.345, .34, -1e6, and
25.4E-72. As with integers, the sign out front is com-
pletely optional and can be matched by "[+-]?". We can see
that if there is no exponent, floating point numbers must
have a decimal point, otherwise they are integers. We might
be tempted to model these with "\d*\.\d*", but this would
also match just a single decimal point, which is not a
number. So the three cases of floating point number sans
exponent are
/[+-]?\d+\./; # 1., 321., etc.
/[+-]?\.\d+/; # .1, .234, etc.
/[+-]?\d+\.\d+/; # 1.0, 30.56, etc.
These can be combined into a single regexp with a three-way
alternation:
/[+-]?(\d+\.\d+|\d+\.|\.\d+)/; # floating point, no exponent
In this alternation, it is important to put '\d+\.\d+'
before '\d+\.'. If '\d+\.' were first, the regexp would
happily match that and ignore the fractional part of the
number.
Now consider floating point numbers with exponents. The key
observation here is that both integers and numbers with
decimal points are allowed in front of an exponent. Then
perl v5.8.8 2006-06-30 22
PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)
exponents, like the overall sign, are independent of whether
we are matching numbers with or without decimal points, and
can be 'decoupled' from the mantissa. The overall form of
the regexp now becomes clear:
/^(optional sign)(integer | f.p. mantissa)(optional exponent)$/;
The exponent is an "e" or "E", followed by an integer. So
the exponent regexp is
/[eE][+-]?\d+/; # exponent
Putting all the parts together, we get a regexp that matches
numbers:
/^[+-]?(\d+\.\d+|\d+\.|\.\d+|\d+)([eE][+-]?\d+)?$/; # Ta da!
Long regexps like this may impress your friends, but can be
hard to decipher. In complex situations like this, the
"//x" modifier for a match is invaluable. It allows one to
put nearly arbitrary whitespace and comments into a regexp
without affecting their meaning. Using it, we can rewrite
our 'extended' regexp in the more pleasing form
/^
[+-]? # first, match an optional sign
( # then match integers or f.p. mantissas:
\d+\.\d+ # mantissa of the form a.b
|\d+\. # mantissa of the form a.
|\.\d+ # mantissa of the form .b
|\d+ # integer of the form a
)
([eE][+-]?\d+)? # finally, optionally match an exponent
$/x;
If whitespace is mostly irrelevant, how does one include
space characters in an extended regexp? The answer is to
backslash it '\ ' or put it in a character class "[ ]" .
The same thing goes for pound signs, use "\#" or "[#]". For
instance, Perl allows a space between the sign and the
mantissa/integer, and we could add this to our regexp as
follows:
perl v5.8.8 2006-06-30 23
PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)
/^
[+-]?\ * # first, match an optional sign *and space*
( # then match integers or f.p. mantissas:
\d+\.\d+ # mantissa of the form a.b
|\d+\. # mantissa of the form a.
|\.\d+ # mantissa of the form .b
|\d+ # integer of the form a
)
([eE][+-]?\d+)? # finally, optionally match an exponent
$/x;
In this form, it is easier to see a way to simplify the
alternation. Alternatives 1, 2, and 4 all start with "\d+",
so it could be factored out:
/^
[+-]?\ * # first, match an optional sign
( # then match integers or f.p. mantissas:
\d+ # start out with a ...
(
\.\d* # mantissa of the form a.b or a.
)? # ? takes care of integers of the form a
|\.\d+ # mantissa of the form .b
)
([eE][+-]?\d+)? # finally, optionally match an exponent
$/x;
or written in the compact form,
/^[+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?$/;
This is our final regexp. To recap, we built a regexp by
+ specifying the task in detail,
+ breaking down the problem into smaller parts,
+ translating the small parts into regexps,
+ combining the regexps,
+ and optimizing the final combined regexp.
These are also the typical steps involved in writing a com-
puter program. This makes perfect sense, because regular
expressions are essentially programs written a little com-
puter language that specifies patterns.
Using regular expressions in Perl
The last topic of Part 1 briefly covers how regexps are used
in Perl programs. Where do they fit into Perl syntax?
perl v5.8.8 2006-06-30 24
PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)
We have already introduced the matching operator in its
default "/regexp/" and arbitrary delimiter "m!regexp!"
forms. We have used the binding operator "=~" and its nega-
tion "!~" to test for string matches. Associated with the
matching operator, we have discussed the single line "//s",
multi-line "//m", case-insensitive "//i" and extended "//x"
modifiers.
There are a few more things you might want to know about
matching operators. First, we pointed out earlier that
variables in regexps are substituted before the regexp is
evaluated:
$pattern = 'Seuss';
while (<>) {
print if /$pattern/;
}
This will print any lines containing the word "Seuss". It
is not as efficient as it could be, however, because perl
has to re-evaluate $pattern each time through the loop. If
$pattern won't be changing over the lifetime of the script,
we can add the "//o" modifier, which directs perl to only
perform variable substitutions once:
#!/usr/bin/perl
# Improved simple_grep
$regexp = shift;
while (<>) {
print if /$regexp/o; # a good deal faster
}
If you change $pattern after the first substitution happens,
perl will ignore it. If you don't want any substitutions at
all, use the special delimiter "m''":
@pattern = ('Seuss');
while (<>) {
print if m'@pattern'; # matches literal '@pattern', not 'Seuss'
}
"m''" acts like single quotes on a regexp; all other "m"
delimiters act like double quotes. If the regexp evaluates
to the empty string, the regexp in the last successful match
is used instead. So we have
"dog" =~ /d/; # 'd' matches
"dogbert =~ //; # this matches the 'd' regexp used before
The final two modifiers "//g" and "//c" concern multiple
matches. The modifier "//g" stands for global matching and
allows the matching operator to match within a string as
perl v5.8.8 2006-06-30 25
PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)
many times as possible. In scalar context, successive invo-
cations against a string will have `"//g" jump from match to
match, keeping track of position in the string as it goes
along. You can get or set the position with the "pos()"
function.
The use of "//g" is shown in the following example. Suppose
we have a string that consists of words separated by spaces.
If we know how many words there are in advance, we could
extract the words using groupings:
$x = "cat dog house"; # 3 words
$x =~ /^\s*(\w+)\s+(\w+)\s+(\w+)\s*$/; # matches,
# $1 = 'cat'
# $2 = 'dog'
# $3 = 'house'
But what if we had an indeterminate number of words? This is
the sort of task "//g" was made for. To extract all words,
form the simple regexp "(\w+)" and loop over all matches
with "/(\w+)/g":
while ($x =~ /(\w+)/g) {
print "Word is $1, ends at position ", pos $x, "\n";
}
prints
Word is cat, ends at position 3
Word is dog, ends at position 7
Word is house, ends at position 13
A failed match or changing the target string resets the
position. If you don't want the position reset after
failure to match, add the "//c", as in "/regexp/gc". The
current position in the string is associated with the
string, not the regexp. This means that different strings
have different positions and their respective positions can
be set or read independently.
In list context, "//g" returns a list of matched groupings,
or if there are no groupings, a list of matches to the whole
regexp. So if we wanted just the words, we could use
@words = ($x =~ /(\w+)/g); # matches,
# $word[0] = 'cat'
# $word[1] = 'dog'
# $word[2] = 'house'
Closely associated with the "//g" modifier is the "\G"
anchor. The "\G" anchor matches at the point where the pre-
vious "//g" match left off. "\G" allows us to easily do
perl v5.8.8 2006-06-30 26
PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)
context-sensitive matching:
$metric = 1; # use metric units
...
$x = <FILE>; # read in measurement
$x =~ /^([+-]?\d+)\s*/g; # get magnitude
$weight = $1;
if ($metric) { # error checking
print "Units error!" unless $x =~ /\Gkg\./g;
}
else {
print "Units error!" unless $x =~ /\Glbs\./g;
}
$x =~ /\G\s+(widget|sprocket)/g; # continue processing
The combination of "//g" and "\G" allows us to process the
string a bit at a time and use arbitrary Perl logic to
decide what to do next. Currently, the "\G" anchor is only
fully supported when used to anchor to the start of the pat-
tern.
"\G" is also invaluable in processing fixed length records
with regexps. Suppose we have a snippet of coding region
DNA, encoded as base pair letters "ATCGTTGAAT..." and we
want to find all the stop codons "TGA". In a coding region,
codons are 3-letter sequences, so we can think of the DNA
snippet as a sequence of 3-letter records. The naive regexp
# expanded, this is "ATC GTT GAA TGC AAA TGA CAT GAC"
$dna = "ATCGTTGAATGCAAATGACATGAC";
$dna =~ /TGA/;
doesn't work; it may match a "TGA", but there is no guaran-
tee that the match is aligned with codon boundaries, e.g.,
the substring "GTT GAA" gives a match. A better solution
is
while ($dna =~ /(\w\w\w)*?TGA/g) { # note the minimal *?
print "Got a TGA stop codon at position ", pos $dna, "\n";
}
which prints
Got a TGA stop codon at position 18
Got a TGA stop codon at position 23
Position 18 is good, but position 23 is bogus. What hap-
pened?
The answer is that our regexp works well until we get past
the last real match. Then the regexp will fail to match a
synchronized "TGA" and start stepping ahead one character
perl v5.8.8 2006-06-30 27
PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)
position at a time, not what we want. The solution is to
use "\G" to anchor the match to the codon alignment:
while ($dna =~ /\G(\w\w\w)*?TGA/g) {
print "Got a TGA stop codon at position ", pos $dna, "\n";
}
This prints
Got a TGA stop codon at position 18
which is the correct answer. This example illustrates that
it is important not only to match what is desired, but to
reject what is not desired.
search and replace
Regular expressions also play a big role in search and
replace operations in Perl. Search and replace is accom-
plished with the "s///" operator. The general form is
"s/regexp/replacement/modifiers", with everything we know
about regexps and modifiers applying in this case as well.
The "replacement" is a Perl double quoted string that
replaces in the string whatever is matched with the
"regexp". The operator "=~" is also used here to associate
a string with "s///". If matching against $_, the "$_ =~"
can be dropped. If there is a match, "s///" returns the
number of substitutions made, otherwise it returns false.
Here are a few examples:
$x = "Time to feed the cat!";
$x =~ s/cat/hacker/; # $x contains "Time to feed the hacker!"
if ($x =~ s/^(Time.*hacker)!$/$1 now!/) {
$more_insistent = 1;
}
$y = "'quoted words'";
$y =~ s/^'(.*)'$/$1/; # strip single quotes,
# $y contains "quoted words"
In the last example, the whole string was matched, but only
the part inside the single quotes was grouped. With the
"s///" operator, the matched variables $1, $2, etc. are
immediately available for use in the replacement expression,
so we use $1 to replace the quoted string with just what was
quoted. With the global modifier, "s///g" will search and
replace all occurrences of the regexp in the string:
perl v5.8.8 2006-06-30 28
PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)
$x = "I batted 4 for 4";
$x =~ s/4/four/; # doesn't do it all:
# $x contains "I batted four for 4"
$x = "I batted 4 for 4";
$x =~ s/4/four/g; # does it all:
# $x contains "I batted four for four"
If you prefer 'regex' over 'regexp' in this tutorial, you
could use the following program to replace it:
% cat > simple_replace
#!/usr/bin/perl
$regexp = shift;
$replacement = shift;
while (<>) {
s/$regexp/$replacement/go;
print;
}
^D
% simple_replace regexp regex perlretut.pod
In "simple_replace" we used the "s///g" modifier to replace
all occurrences of the regexp on each line and the "s///o"
modifier to compile the regexp only once. As with
"simple_grep", both the "print" and the
"s/$regexp/$replacement/go" use $_ implicitly.
A modifier available specifically to search and replace is
the "s///e" evaluation modifier. "s///e" wraps an
"eval{...}" around the replacement string and the evaluated
result is substituted for the matched substring. "s///e" is
useful if you need to do a bit of computation in the process
of replacing text. This example counts character frequen-
cies in a line:
$x = "Bill the cat";
$x =~ s/(.)/$chars{$1}++;$1/eg; # final $1 replaces char with itself
print "frequency of '$_' is $chars{$_}\n"
foreach (sort {$chars{$b} <=> $chars{$a}} keys %chars);
This prints
frequency of ' ' is 2
frequency of 't' is 2
frequency of 'l' is 2
frequency of 'B' is 1
frequency of 'c' is 1
frequency of 'e' is 1
frequency of 'h' is 1
frequency of 'i' is 1
frequency of 'a' is 1
perl v5.8.8 2006-06-30 29
PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)
As with the match "m//" operator, "s///" can use other del-
imiters, such as "s!!!" and "s{}{}", and even "s{}//". If
single quotes are used "s'''", then the regexp and replace-
ment are treated as single quoted strings and there are no
substitutions. "s///" in list context returns the same
thing as in scalar context, i.e., the number of matches.
The split operator
The "split" function can also optionally use a matching
operator "m//" to split a string. "split /regexp/, string,
limit" splits "string" into a list of substrings and returns
that list. The regexp is used to match the character
sequence that the "string" is split with respect to. The
"limit", if present, constrains splitting into no more than
"limit" number of strings. For example, to split a string
into words, use
$x = "Calvin and Hobbes";
@words = split /\s+/, $x; # $word[0] = 'Calvin'
# $word[1] = 'and'
# $word[2] = 'Hobbes'
If the empty regexp "//" is used, the regexp always matches
and the string is split into individual characters. If the
regexp has groupings, then list produced contains the
matched substrings from the groupings as well. For
instance,
$x = "/usr/bin/perl";
@dirs = split m!/!, $x; # $dirs[0] = ''
# $dirs[1] = 'usr'
# $dirs[2] = 'bin'
# $dirs[3] = 'perl'
@parts = split m!(/)!, $x; # $parts[0] = ''
# $parts[1] = '/'
# $parts[2] = 'usr'
# $parts[3] = '/'
# $parts[4] = 'bin'
# $parts[5] = '/'
# $parts[6] = 'perl'
Since the first character of $x matched the regexp, "split"
prepended an empty initial element to the list.
If you have read this far, congratulations! You now have all
the basic tools needed to use regular expressions to solve a
wide range of text processing problems. If this is your
first time through the tutorial, why not stop here and play
around with regexps a while... Part 2 concerns the more
esoteric aspects of regular expressions and those concepts
certainly aren't needed right at the start.
perl v5.8.8 2006-06-30 30
PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)Part 2: Power tools
OK, you know the basics of regexps and you want to know
more. If matching regular expressions is analogous to a
walk in the woods, then the tools discussed in Part 1 are
analogous to topo maps and a compass, basic tools we use all
the time. Most of the tools in part 2 are analogous to
flare guns and satellite phones. They aren't used too often
on a hike, but when we are stuck, they can be invaluable.
What follows are the more advanced, less used, or sometimes
esoteric capabilities of perl regexps. In Part 2, we will
assume you are comfortable with the basics and concentrate
on the new features.
More on characters, strings, and character classes
There are a number of escape sequences and character classes
that we haven't covered yet.
There are several escape sequences that convert characters
or strings between upper and lower case. "\l" and "\u" con-
vert the next character to lower or upper case, respec-
tively:
$x = "perl";
$string =~ /\u$x/; # matches 'Perl' in $string
$x = "M(rs?|s)\\."; # note the double backslash
$string =~ /\l$x/; # matches 'mr.', 'mrs.', and 'ms.',
"\L" and "\U" converts a whole substring, delimited by "\L"
or "\U" and "\E", to lower or upper case:
$x = "This word is in lower case:\L SHOUT\E";
$x =~ /shout/; # matches
$x = "I STILL KEYPUNCH CARDS FOR MY 360"
$x =~ /\Ukeypunch/; # matches punch card string
If there is no "\E", case is converted until the end of the
string. The regexps "\L\u$word" or "\u\L$word" convert the
first character of $word to uppercase and the rest of the
characters to lowercase.
Control characters can be escaped with "\c", so that a
control-Z character would be matched with "\cZ". The escape
sequence "\Q"..."\E" quotes, or protects most non-alphabetic
characters. For instance,
$x = "\QThat !^*&%~& cat!";
$x =~ /\Q!^*&%~&\E/; # check for rough language
It does not protect "$" or "@", so that variables can still
be substituted.
perl v5.8.8 2006-06-30 31
PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)
With the advent of 5.6.0, perl regexps can handle more than
just the standard ASCII character set. Perl now supports
Unicode, a standard for encoding the character sets from
many of the world's written languages. Unicode does this by
allowing characters to be more than one byte wide. Perl
uses the UTF-8 encoding, in which ASCII characters are still
encoded as one byte, but characters greater than "chr(127)"
may be stored as two or more bytes.
What does this mean for regexps? Well, regexp users don't
need to know much about perl's internal representation of
strings. But they do need to know 1) how to represent
Unicode characters in a regexp and 2) when a matching opera-
tion will treat the string to be searched as a sequence of
bytes (the old way) or as a sequence of Unicode characters
(the new way). The answer to 1) is that Unicode characters
greater than "chr(127)" may be represented using the
"\x{hex}" notation, with "hex" a hexadecimal integer:
/\x{263a}/; # match a Unicode smiley face :)
Unicode characters in the range of 128-255 use two hexade-
cimal digits with braces: "\x{ab}". Note that this is dif-
ferent than "\xab", which is just a hexadecimal byte with no
Unicode significance.
NOTE: in Perl 5.6.0 it used to be that one needed to say
"use utf8" to use any Unicode features. This is no more the
case: for almost all Unicode processing, the explicit "utf8"
pragma is not needed. (The only case where it matters is if
your Perl script is in Unicode and encoded in UTF-8, then an
explicit "use utf8" is needed.)
Figuring out the hexadecimal sequence of a Unicode character
you want or deciphering someone else's hexadecimal Unicode
regexp is about as much fun as programming in machine code.
So another way to specify Unicode characters is to use the
named character escape sequence "\N{name}". "name" is a
name for the Unicode character, as specified in the Unicode
standard. For instance, if we wanted to represent or match
the astrological sign for the planet Mercury, we could use
use charnames ":full"; # use named chars with Unicode full names
$x = "abc\N{MERCURY}def";
$x =~ /\N{MERCURY}/; # matches
One can also use short names or restrict names to a certain
alphabet:
use charnames ':full';
print "\N{GREEK SMALL LETTER SIGMA} is called sigma.\n";
perl v5.8.8 2006-06-30 32
PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)
use charnames ":short";
print "\N{greek:Sigma} is an upper-case sigma.\n";
use charnames qw(greek);
print "\N{sigma} is Greek sigma\n";
A list of full names is found in the file Names.txt in the
lib/perl5/5.X.X/unicore directory.
The answer to requirement 2), as of 5.6.0, is that if a
regexp contains Unicode characters, the string is searched
as a sequence of Unicode characters. Otherwise, the string
is searched as a sequence of bytes. If the string is being
searched as a sequence of Unicode characters, but matching a
single byte is required, we can use the "\C" escape
sequence. "\C" is a character class akin to "." except that
it matches any byte 0-255. So
use charnames ":full"; # use named chars with Unicode full names
$x = "a";
$x =~ /\C/; # matches 'a', eats one byte
$x = "";
$x =~ /\C/; # doesn't match, no bytes to match
$x = "\N{MERCURY}"; # two-byte Unicode character
$x =~ /\C/; # matches, but dangerous!
The last regexp matches, but is dangerous because the string
character position is no longer synchronized to the string
byte position. This generates the warning 'Malformed UTF-8
character'. The "\C" is best used for matching the binary
data in strings with binary data intermixed with Unicode
characters.
Let us now discuss the rest of the character classes. Just
as with Unicode characters, there are named Unicode charac-
ter classes represented by the "\p{name}" escape sequence.
Closely associated is the "\P{name}" character class, which
is the negation of the "\p{name}" class. For example, to
match lower and uppercase characters,
use charnames ":full"; # use named chars with Unicode full names
$x = "BOB";
$x =~ /^\p{IsUpper}/; # matches, uppercase char class
$x =~ /^\P{IsUpper}/; # doesn't match, char class sans uppercase
$x =~ /^\p{IsLower}/; # doesn't match, lowercase char class
$x =~ /^\P{IsLower}/; # matches, char class sans lowercase
Here is the association between some Perl named classes and
the traditional Unicode classes:
Perl class name Unicode class name or regular expression
perl v5.8.8 2006-06-30 33
PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)
IsAlpha /^[LM]/
IsAlnum /^[LMN]/
IsASCII $code <= 127
IsCntrl /^C/
IsBlank $code =~ /^(0020|0009)$/ || /^Z[^lp]/
IsDigit Nd
IsGraph /^([LMNPS]|Co)/
IsLower Ll
IsPrint /^([LMNPS]|Co|Zs)/
IsPunct /^P/
IsSpace /^Z/ || ($code =~ /^(0009|000A|000B|000C|000D)$/
IsSpacePerl /^Z/ || ($code =~ /^(0009|000A|000C|000D|0085|2028|2029)$/
IsUpper /^L[ut]/
IsWord /^[LMN]/ || $code eq "005F"
IsXDigit $code =~ /^00(3[0-9]|[46][1-6])$/
You can also use the official Unicode class names with the
"\p" and "\P", like "\p{L}" for Unicode 'letters', or
"\p{Lu}" for uppercase letters, or "\P{Nd}" for non-digits.
If a "name" is just one letter, the braces can be dropped.
For instance, "\pM" is the character class of Unicode
'marks', for example accent marks. For the full list see
perlunicode.
The Unicode has also been separated into various sets of
characters which you can test with "\p{In...}" (in) and
"\P{In...}" (not in), for example "\p{Latin}", "\p{Greek}",
or "\P{Katakana}". For the full list see perlunicode.
"\X" is an abbreviation for a character class sequence that
includes the Unicode 'combining character sequences'. A
'combining character sequence' is a base character followed
by any number of combining characters. An example of a com-
bining character is an accent. Using the Unicode full
names, e.g., "A + COMBINING RING" is a combining character
sequence with base character "A" and combining character
"COMBINING RING" , which translates in Danish to A with the
circle atop it, as in the word Angstrom. "\X" is equivalent
to "\PM\pM*}", i.e., a non-mark followed by one or more
marks.
For the full and latest information about Unicode see the
latest Unicode standard, or the Unicode Consortium's website
http://www.unicode.org/
As if all those classes weren't enough, Perl also defines
POSIX style character classes. These have the form
"[:name:]", with "name" the name of the POSIX class. The
POSIX classes are "alpha", "alnum", "ascii", "cntrl",
"digit", "graph", "lower", "print", "punct", "space",
"upper", and "xdigit", and two extensions, "word" (a Perl
extension to match "\w"), and "blank" (a GNU extension). If
perl v5.8.8 2006-06-30 34
PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)
"utf8" is being used, then these classes are defined the
same as their corresponding perl Unicode classes:
"[:upper:]" is the same as "\p{IsUpper}", etc. The POSIX
character classes, however, don't require using "utf8". The
"[:digit:]", "[:word:]", and "[:space:]" correspond to the
familiar "\d", "\w", and "\s" character classes. To negate
a POSIX class, put a "^" in front of the name, so that,
e.g., "[:^digit:]" corresponds to "\D" and under "utf8",
"\P{IsDigit}". The Unicode and POSIX character classes can
be used just like "\d", with the exception that POSIX char-
acter classes can only be used inside of a character class:
/\s+[abc[:digit:]xyz]\s*/; # match a,b,c,x,y,z, or a digit
/^=item\s[[:digit:]]/; # match '=item',
# followed by a space and a digit
use charnames ":full";
/\s+[abc\p{IsDigit}xyz]\s+/; # match a,b,c,x,y,z, or a digit
/^=item\s\p{IsDigit}/; # match '=item',
# followed by a space and a digit
Whew! That is all the rest of the characters and character
classes.
Compiling and saving regular expressions
In Part 1 we discussed the "//o" modifier, which compiles a
regexp just once. This suggests that a compiled regexp is
some data structure that can be stored once and used again
and again. The regexp quote "qr//" does exactly that:
"qr/string/" compiles the "string" as a regexp and
transforms the result into a form that can be assigned to a
variable:
$reg = qr/foo+bar?/; # reg contains a compiled regexp
Then $reg can be used as a regexp:
$x = "fooooba";
$x =~ $reg; # matches, just like /foo+bar?/
$x =~ /$reg/; # same thing, alternate form
$reg can also be interpolated into a larger regexp:
$x =~ /(abc)?$reg/; # still matches
As with the matching operator, the regexp quote can use dif-
ferent delimiters, e.g., "qr!!", "qr{}" and "qr~~". The
single quote delimiters "qr''" prevent any interpolation
from taking place.
Pre-compiled regexps are useful for creating dynamic matches
that don't need to be recompiled each time they are
perl v5.8.8 2006-06-30 35
PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)
encountered. Using pre-compiled regexps, "simple_grep" pro-
gram can be expanded into a program that matches multiple
patterns:
% cat > multi_grep
#!/usr/bin/perl
# multi_grep - match any of <number> regexps
# usage: multi_grep <number> regexp1 regexp2 ... file1 file2 ...
$number = shift;
$regexp[$_] = shift foreach (0..$number-1);
@compiled = map qr/$_/, @regexp;
while ($line = <>) {
foreach $pattern (@compiled) {
if ($line =~ /$pattern/) {
print $line;
last; # we matched, so move onto the next line
}
}
}
^D
% multi_grep 2 last for multi_grep
$regexp[$_] = shift foreach (0..$number-1);
foreach $pattern (@compiled) {
last;
Storing pre-compiled regexps in an array @compiled allows us
to simply loop through the regexps without any recompila-
tion, thus gaining flexibility without sacrificing speed.
Embedding comments and modifiers in a regular expression
Starting with this section, we will be discussing Perl's set
of extended patterns. These are extensions to the tradi-
tional regular expression syntax that provide powerful new
tools for pattern matching. We have already seen extensions
in the form of the minimal matching constructs "??", "*?",
"+?", "{n,m}?", and "{n,}?". The rest of the extensions
below have the form "(?char...)", where the "char" is a
character that determines the type of extension.
The first extension is an embedded comment "(?#text)". This
embeds a comment into the regular expression without affect-
ing its meaning. The comment should not have any closing
parentheses in the text. An example is
/(?# Match an integer:)[+-]?\d+/;
This style of commenting has been largely superseded by the
raw, freeform commenting that is allowed with the "//x"
modifier.
perl v5.8.8 2006-06-30 36
PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)
The modifiers "//i", "//m", "//s", and "//x" can also embed-
ded in a regexp using "(?i)", "(?m)", "(?s)", and "(?x)".
For instance,
/(?i)yes/; # match 'yes' case insensitively
/yes/i; # same thing
/(?x)( # freeform version of an integer regexp
[+-]? # match an optional sign
\d+ # match a sequence of digits
)
/x;
Embedded modifiers can have two important advantages over
the usual modifiers. Embedded modifiers allow a custom set
of modifiers to each regexp pattern. This is great for
matching an array of regexps that must have different modif-
iers:
$pattern[0] = '(?i)doctor';
$pattern[1] = 'Johnson';
...
while (<>) {
foreach $patt (@pattern) {
print if /$patt/;
}
}
The second advantage is that embedded modifiers only affect
the regexp inside the group the embedded modifier is con-
tained in. So grouping can be used to localize the
modifier's effects:
/Answer: ((?i)yes)/; # matches 'Answer: yes', 'Answer: YES', etc.
Embedded modifiers can also turn off any modifiers already
present by using, e.g., "(?-i)". Modifiers can also be com-
bined into a single expression, e.g., "(?s-i)" turns on sin-
gle line mode and turns off case insensitivity.
Non-capturing groupings
We noted in Part 1 that groupings "()" had two distinct
functions: 1) group regexp elements together as a single
unit, and 2) extract, or capture, substrings that matched
the regexp in the grouping. Non-capturing groupings,
denoted by "(?:regexp)", allow the regexp to be treated as a
single unit, but don't extract substrings or set matching
variables $1, etc. Both capturing and non-capturing group-
ings are allowed to co-exist in the same regexp. Because
there is no extraction, non-capturing groupings are faster
than capturing groupings. Non-capturing groupings are also
handy for choosing exactly which parts of a regexp are to be
perl v5.8.8 2006-06-30 37
PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)
extracted to matching variables:
# match a number, $1-$4 are set, but we only want $1
/([+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?)/;
# match a number faster , only $1 is set
/([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE][+-]?\d+)?)/;
# match a number, get $1 = whole number, $2 = exponent
/([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE]([+-]?\d+))?)/;
Non-capturing groupings are also useful for removing nui-
sance elements gathered from a split operation:
$x = '12a34b5';
@num = split /(a|b)/, $x; # @num = ('12','a','34','b','5')
@num = split /(?:a|b)/, $x; # @num = ('12','34','5')
Non-capturing groupings may also have embedded modifiers:
"(?i-m:regexp)" is a non-capturing grouping that matches
"regexp" case insensitively and turns off multi-line mode.
Looking ahead and looking behind
This section concerns the lookahead and lookbehind asser-
tions. First, a little background.
In Perl regular expressions, most regexp elements 'eat up' a
certain amount of string when they match. For instance, the
regexp element "[abc}]" eats up one character of the string
when it matches, in the sense that perl moves to the next
character position in the string after the match. There are
some elements, however, that don't eat up characters
(advance the character position) if they match. The exam-
ples we have seen so far are the anchors. The anchor "^"
matches the beginning of the line, but doesn't eat any char-
acters. Similarly, the word boundary anchor "\b" matches,
e.g., if the character to the left is a word character and
the character to the right is a non-word character, but it
doesn't eat up any characters itself. Anchors are examples
of 'zero-width assertions'. Zero-width, because they con-
sume no characters, and assertions, because they test some
property of the string. In the context of our walk in the
woods analogy to regexp matching, most regexp elements move
us along a trail, but anchors have us stop a moment and
check our surroundings. If the local environment checks
out, we can proceed forward. But if the local environment
doesn't satisfy us, we must backtrack.
Checking the environment entails either looking ahead on the
trail, looking behind, or both. "^" looks behind, to see
that there are no characters before. "$" looks ahead, to
perl v5.8.8 2006-06-30 38
PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)
see that there are no characters after. "\b" looks both
ahead and behind, to see if the characters on either side
differ in their 'word'-ness.
The lookahead and lookbehind assertions are generalizations
of the anchor concept. Lookahead and lookbehind are zero-
width assertions that let us specify which characters we
want to test for. The lookahead assertion is denoted by
"(?=regexp)" and the lookbehind assertion is denoted by
"(?<=fixed-regexp)". Some examples are
$x = "I catch the housecat 'Tom-cat' with catnip";
$x =~ /cat(?=\s+)/; # matches 'cat' in 'housecat'
@catwords = ($x =~ /(?<=\s)cat\w+/g); # matches,
# $catwords[0] = 'catch'
# $catwords[1] = 'catnip'
$x =~ /\bcat\b/; # matches 'cat' in 'Tom-cat'
$x =~ /(?<=\s)cat(?=\s)/; # doesn't match; no isolated 'cat' in
# middle of $x
Note that the parentheses in "(?=regexp)" and "(?<=regexp)"
are non-capturing, since these are zero-width assertions.
Thus in the second regexp, the substrings captured are those
of the whole regexp itself. Lookahead "(?=regexp)" can
match arbitrary regexps, but lookbehind "(?<=fixed-regexp)"
only works for regexps of fixed width, i.e., a fixed number
of characters long. Thus "(?<=(ab|bc))" is fine, but
"(?<=(ab)*)" is not. The negated versions of the lookahead
and lookbehind assertions are denoted by "(?!regexp)" and
"(?<!fixed-regexp)" respectively. They evaluate true if the
regexps do not match:
$x = "foobar";
$x =~ /foo(?!bar)/; # doesn't match, 'bar' follows 'foo'
$x =~ /foo(?!baz)/; # matches, 'baz' doesn't follow 'foo'
$x =~ /(?<!\s)foo/; # matches, there is no \s before 'foo'
The "\C" is unsupported in lookbehind, because the already
treacherous definition of "\C" would become even more so
when going backwards.
Using independent subexpressions to prevent backtracking
The last few extended patterns in this tutorial are experi-
mental as of 5.6.0. Play with them, use them in some code,
but don't rely on them just yet for production code.
Independent subexpressions are regular expressions, in the
context of a larger regular expression, that function
independently of the larger regular expression. That is,
they consume as much or as little of the string as they wish
without regard for the ability of the larger regexp to
perl v5.8.8 2006-06-30 39
PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)
match. Independent subexpressions are represented by
"(?>regexp)". We can illustrate their behavior by first
considering an ordinary regexp:
$x = "ab";
$x =~ /a*ab/; # matches
This obviously matches, but in the process of matching, the
subexpression "a*" first grabbed the "a". Doing so, how-
ever, wouldn't allow the whole regexp to match, so after
backtracking, "a*" eventually gave back the "a" and matched
the empty string. Here, what "a*" matched was dependent on
what the rest of the regexp matched.
Contrast that with an independent subexpression:
$x =~ /(?>a*)ab/; # doesn't match!
The independent subexpression "(?>a*)" doesn't care about
the rest of the regexp, so it sees an "a" and grabs it.
Then the rest of the regexp "ab" cannot match. Because
"(?>a*)" is independent, there is no backtracking and the
independent subexpression does not give up its "a". Thus
the match of the regexp as a whole fails. A similar
behavior occurs with completely independent regexps:
$x = "ab";
$x =~ /a*/g; # matches, eats an 'a'
$x =~ /\Gab/g; # doesn't match, no 'a' available
Here "//g" and "\G" create a 'tag team' handoff of the
string from one regexp to the other. Regexps with an
independent subexpression are much like this, with a handoff
of the string to the independent subexpression, and a hand-
off of the string back to the enclosing regexp.
The ability of an independent subexpression to prevent back-
tracking can be quite useful. Suppose we want to match a
non-empty string enclosed in parentheses up to two levels
deep. Then the following regexp matches:
$x = "abc(de(fg)h"; # unbalanced parentheses
$x =~ /\( ( [^()]+ | \([^()]*\) )+ \)/x;
The regexp matches an open parenthesis, one or more copies
of an alternation, and a close parenthesis. The alternation
is two-way, with the first alternative "[^()]+" matching a
substring with no parentheses and the second alternative
"\([^()]*\)" matching a substring delimited by parentheses.
The problem with this regexp is that it is pathological: it
has nested indeterminate quantifiers of the form "(a+|b)+".
We discussed in Part 1 how nested quantifiers like this
perl v5.8.8 2006-06-30 40
PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)
could take an exponentially long time to execute if there
was no match possible. To prevent the exponential blowup,
we need to prevent useless backtracking at some point. This
can be done by enclosing the inner quantifier as an indepen-
dent subexpression:
$x =~ /\( ( (?>[^()]+) | \([^()]*\) )+ \)/x;
Here, "(?>[^()]+)" breaks the degeneracy of string parti-
tioning by gobbling up as much of the string as possible and
keeping it. Then match failures fail much more quickly.
Conditional expressions
A conditional expression is a form of if-then-else state-
ment that allows one to choose which patterns are to be
matched, based on some condition. There are two types of
conditional expression: "(?(condition)yes-regexp)" and
"(?(condition)yes-regexp|no-regexp)".
"(?(condition)yes-regexp)" is like an 'if () {}' statement
in Perl. If the "condition" is true, the "yes-regexp" will
be matched. If the "condition" is false, the "yes-regexp"
will be skipped and perl will move onto the next regexp ele-
ment. The second form is like an 'if () {} else {}' state-
ment in Perl. If the "condition" is true, the "yes-regexp"
will be matched, otherwise the "no-regexp" will be matched.
The "condition" can have two forms. The first form is sim-
ply an integer in parentheses "(integer)". It is true if
the corresponding backreference "\integer" matched earlier
in the regexp. The second form is a bare zero width asser-
tion "(?...)", either a lookahead, a lookbehind, or a code
assertion (discussed in the next section).
The integer form of the "condition" allows us to choose,
with more flexibility, what to match based on what matched
earlier in the regexp. This searches for words of the form
"$x$x" or "$x$y$y$x":
% simple_grep '^(\w+)(\w+)?(?(2)\2\1|\1)$' /usr/dict/words
beriberi
coco
couscous
deed
...
toot
toto
tutu
The lookbehind "condition" allows, along with backrefer-
ences, an earlier part of the match to influence a later
part of the match. For instance,
perl v5.8.8 2006-06-30 41
PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)
/[ATGC]+(?(?<=AA)G|C)$/;
matches a DNA sequence such that it either ends in "AAG", or
some other base pair combination and "C". Note that the
form is "(?(?<=AA)G|C)" and not "(?((?<=AA))G|C)"; for the
lookahead, lookbehind or code assertions, the parentheses
around the conditional are not needed.
A bit of magic: executing Perl code in a regular expression
Normally, regexps are a part of Perl expressions.
Code evaluation expressions turn that around by allowing
arbitrary Perl code to be a part of a regexp. A code
evaluation expression is denoted "(?{code})", with "code" a
string of Perl statements.
Code expressions are zero-width assertions, and the value
they return depends on their environment. There are two
possibilities: either the code expression is used as a con-
ditional in a conditional expression "(?(condition)...)", or
it is not. If the code expression is a conditional, the
code is evaluated and the result (i.e., the result of the
last statement) is used to determine truth or falsehood. If
the code expression is not used as a conditional, the asser-
tion always evaluates true and the result is put into the
special variable $^R. The variable $^R can then be used in
code expressions later in the regexp. Here are some silly
examples:
$x = "abcdef";
$x =~ /abc(?{print "Hi Mom!";})def/; # matches,
# prints 'Hi Mom!'
$x =~ /aaa(?{print "Hi Mom!";})def/; # doesn't match,
# no 'Hi Mom!'
Pay careful attention to the next example:
$x =~ /abc(?{print "Hi Mom!";})ddd/; # doesn't match,
# no 'Hi Mom!'
# but why not?
At first glance, you'd think that it shouldn't print,
because obviously the "ddd" isn't going to match the target
string. But look at this example:
$x =~ /abc(?{print "Hi Mom!";})[d]dd/; # doesn't match,
# but _does_ print
Hmm. What happened here? If you've been following along, you
know that the above pattern should be effectively the same
as the last one -- enclosing the d in a character class
isn't going to change what it matches. So why does the first
perl v5.8.8 2006-06-30 42
PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)
not print while the second one does?
The answer lies in the optimizations the REx engine makes.
In the first case, all the engine sees are plain old charac-
ters (aside from the "?{}" construct). It's smart enough to
realize that the string 'ddd' doesn't occur in our target
string before actually running the pattern through. But in
the second case, we've tricked it into thinking that our
pattern is more complicated than it is. It takes a look,
sees our character class, and decides that it will have to
actually run the pattern to determine whether or not it
matches, and in the process of running it hits the print
statement before it discovers that we don't have a match.
To take a closer look at how the engine does optimizations,
see the section "Pragmas and debugging" below.
More fun with "?{}":
$x =~ /(?{print "Hi Mom!";})/; # matches,
# prints 'Hi Mom!'
$x =~ /(?{$c = 1;})(?{print "$c";})/; # matches,
# prints '1'
$x =~ /(?{$c = 1;})(?{print "$^R";})/; # matches,
# prints '1'
The bit of magic mentioned in the section title occurs when
the regexp backtracks in the process of searching for a
match. If the regexp backtracks over a code expression and
if the variables used within are localized using "local",
the changes in the variables produced by the code expression
are undone! Thus, if we wanted to count how many times a
character got matched inside a group, we could use, e.g.,
$x = "aaaa";
$count = 0; # initialize 'a' count
$c = "bob"; # test if $c gets clobbered
$x =~ /(?{local $c = 0;}) # initialize count
( a # match 'a'
(?{local $c = $c + 1;}) # increment count
)* # do this any number of times,
aa # but match 'aa' at the end
(?{$count = $c;}) # copy local $c var into $count
/x;
print "'a' count is $count, \$c variable is '$c'\n";
This prints
'a' count is 2, $c variable is 'bob'
If we replace the " (?{local $c = $c + 1;})" with
" (?{$c = $c + 1;})" , the variable changes are not undone
perl v5.8.8 2006-06-30 43
PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)
during backtracking, and we get
'a' count is 4, $c variable is 'bob'
Note that only localized variable changes are undone. Other
side effects of code expression execution are permanent.
Thus
$x = "aaaa";
$x =~ /(a(?{print "Yow\n";}))*aa/;
produces
Yow
Yow
Yow
Yow
The result $^R is automatically localized, so that it will
behave properly in the presence of backtracking.
This example uses a code expression in a conditional to
match the article 'the' in either English or German:
$lang = 'DE'; # use German
...
$text = "das";
print "matched\n"
if $text =~ /(?(?{
$lang eq 'EN'; # is the language English?
})
the | # if so, then match 'the'
(die|das|der) # else, match 'die|das|der'
)
/xi;
Note that the syntax here is
"(?(?{...})yes-regexp|no-regexp)", not
"(?((?{...}))yes-regexp|no-regexp)". In other words, in the
case of a code expression, we don't need the extra
parentheses around the conditional.
If you try to use code expressions with interpolating vari-
ables, perl may surprise you:
$bar = 5;
$pat = '(?{ 1 })';
/foo(?{ $bar })bar/; # compiles ok, $bar not interpolated
/foo(?{ 1 })$bar/; # compile error!
/foo${pat}bar/; # compile error!
perl v5.8.8 2006-06-30 44
PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)
$pat = qr/(?{ $foo = 1 })/; # precompile code regexp
/foo${pat}bar/; # compiles ok
If a regexp has (1) code expressions and interpolating vari-
ables, or (2) a variable that interpolates a code expres-
sion, perl treats the regexp as an error. If the code
expression is precompiled into a variable, however, interpo-
lating is ok. The question is, why is this an error?
The reason is that variable interpolation and code expres-
sions together pose a security risk. The combination is
dangerous because many programmers who write search engines
often take user input and plug it directly into a regexp:
$regexp = <>; # read user-supplied regexp
$chomp $regexp; # get rid of possible newline
$text =~ /$regexp/; # search $text for the $regexp
If the $regexp variable contains a code expression, the user
could then execute arbitrary Perl code. For instance, some
joker could search for "system('rm -rf *');" to erase your
files. In this sense, the combination of interpolation and
code expressions taints your regexp. So by default, using
both interpolation and code expressions in the same regexp
is not allowed. If you're not concerned about malicious
users, it is possible to bypass this security check by
invoking "use re 'eval'" :
use re 'eval'; # throw caution out the door
$bar = 5;
$pat = '(?{ 1 })';
/foo(?{ 1 })$bar/; # compiles ok
/foo${pat}bar/; # compiles ok
Another form of code expression is the
pattern code expression . The pattern code expression is
like a regular code expression, except that the result of
the code evaluation is treated as a regular expression and
matched immediately. A simple example is
$length = 5;
$char = 'a';
$x = 'aaaaabb';
$x =~ /(??{$char x $length})/x; # matches, there are 5 of 'a'
This final example contains both ordinary and pattern code
expressions. It detects if a binary string
1101010010001... has a Fibonacci spacing 0,1,1,2,3,5,... of
the 1's:
perl v5.8.8 2006-06-30 45
PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)
$s0 = 0; $s1 = 1; # initial conditions
$x = "1101010010001000001";
print "It is a Fibonacci sequence\n"
if $x =~ /^1 # match an initial '1'
(
(??{'0' x $s0}) # match $s0 of '0'
1 # and then a '1'
(?{
$largest = $s0; # largest seq so far
$s2 = $s1 + $s0; # compute next term
$s0 = $s1; # in Fibonacci sequence
$s1 = $s2;
})
)+ # repeat as needed
$ # that is all there is
/x;
print "Largest sequence matched was $largest\n";
This prints
It is a Fibonacci sequence
Largest sequence matched was 5
Ha! Try that with your garden variety regexp package...
Note that the variables $s0 and $s1 are not substituted when
the regexp is compiled, as happens for ordinary variables
outside a code expression. Rather, the code expressions are
evaluated when perl encounters them during the search for a
match.
The regexp without the "//x" modifier is
/^1((??{'0'x$s0})1(?{$largest=$s0;$s2=$s1+$s0$s0=$s1;$s1=$s2;}))+$/;
and is a great start on an Obfuscated Perl entry :-) When
working with code and conditional expressions, the extended
form of regexps is almost necessary in creating and debug-
ging regexps.
Pragmas and debugging
Speaking of debugging, there are several pragmas available
to control and debug regexps in Perl. We have already
encountered one pragma in the previous section,
"use re 'eval';" , that allows variable interpolation and
code expressions to coexist in a regexp. The other pragmas
are
use re 'taint';
$tainted = <>;
@parts = ($tainted =~ /(\w+)\s+(\w+)/; # @parts is now tainted
perl v5.8.8 2006-06-30 46
PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)
The "taint" pragma causes any substrings from a match with a
tainted variable to be tainted as well. This is not nor-
mally the case, as regexps are often used to extract the
safe bits from a tainted variable. Use "taint" when you are
not extracting safe bits, but are performing some other pro-
cessing. Both "taint" and "eval" pragmas are lexically
scoped, which means they are in effect only until the end of
the block enclosing the pragmas.
use re 'debug';
/^(.*)$/s; # output debugging info
use re 'debugcolor';
/^(.*)$/s; # output debugging info in living color
The global "debug" and "debugcolor" pragmas allow one to get
detailed debugging info about regexp compilation and execu-
tion. "debugcolor" is the same as debug, except the debug-
ging information is displayed in color on terminals that can
display termcap color sequences. Here is example output:
% perl -e 'use re "debug"; "abc" =~ /a*b+c/;'
Compiling REx `a*b+c'
size 9 first at 1
1: STAR(4)
2: EXACT <a>(0)
4: PLUS(7)
5: EXACT <b>(0)
7: EXACT <c>(9)
9: END(0)
floating `bc' at 0..2147483647 (checking floating) minlen 2
Guessing start of match, REx `a*b+c' against `abc'...
Found floating substr `bc' at offset 1...
Guessed: match at offset 0
Matching REx `a*b+c' against `abc'
Setting an EVAL scope, savestack=3
0 <> <abc> | 1: STAR
EXACT <a> can match 1 times out of 32767...
Setting an EVAL scope, savestack=3
1 <a> <bc> | 4: PLUS
EXACT <b> can match 1 times out of 32767...
Setting an EVAL scope, savestack=3
2 <ab> <c> | 7: EXACT <c>
3 <abc> <> | 9: END
Match successful!
Freeing REx: `a*b+c'
If you have gotten this far into the tutorial, you can prob-
ably guess what the different parts of the debugging output
tell you. The first part
perl v5.8.8 2006-06-30 47
PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)
Compiling REx `a*b+c'
size 9 first at 1
1: STAR(4)
2: EXACT <a>(0)
4: PLUS(7)
5: EXACT <b>(0)
7: EXACT <c>(9)
9: END(0)
describes the compilation stage. STAR(4) means that there
is a starred object, in this case 'a', and if it matches,
goto line 4, i.e., PLUS(7). The middle lines describe some
heuristics and optimizations performed before a match:
floating `bc' at 0..2147483647 (checking floating) minlen 2
Guessing start of match, REx `a*b+c' against `abc'...
Found floating substr `bc' at offset 1...
Guessed: match at offset 0
Then the match is executed and the remaining lines describe
the process:
Matching REx `a*b+c' against `abc'
Setting an EVAL scope, savestack=3
0 <> <abc> | 1: STAR
EXACT <a> can match 1 times out of 32767...
Setting an EVAL scope, savestack=3
1 <a> <bc> | 4: PLUS
EXACT <b> can match 1 times out of 32767...
Setting an EVAL scope, savestack=3
2 <ab> <c> | 7: EXACT <c>
3 <abc> <> | 9: END
Match successful!
Freeing REx: `a*b+c'
Each step is of the form "n <x> <y>" , with "<x>" the part
of the string matched and "<y>" the part not yet matched.
The "| 1: STAR" says that perl is at line number 1 n the
compilation list above. See "Debugging regular expressions"
in perldebguts for much more detail.
An alternative method of debugging regexps is to embed
"print" statements within the regexp. This provides a
blow-by-blow account of the backtracking in an alternation:
perl v5.8.8 2006-06-30 48
PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)
"that this" =~ m@(?{print "Start at position ", pos, "\n";})
t(?{print "t1\n";})
h(?{print "h1\n";})
i(?{print "i1\n";})
s(?{print "s1\n";})
|
t(?{print "t2\n";})
h(?{print "h2\n";})
a(?{print "a2\n";})
t(?{print "t2\n";})
(?{print "Done at position ", pos, "\n";})
@x;
prints
Start at position 0
t1
h1
t2
h2
a2
t2
Done at position 4
BUGS
Code expressions, conditional expressions, and independent
expressions are experimental. Don't use them in production
code. Yet.
SEE ALSO
This is just a tutorial. For the full story on perl regular
expressions, see the perlre regular expressions reference
page.
For more information on the matching "m//" and substitution
"s///" operators, see "Regexp Quote-Like Operators" in per-
lop. For information on the "split" operation, see "split"
in perlfunc.
For an excellent all-around resource on the care and feeding
of regular expressions, see the book Mastering Regular
Expressions by Jeffrey Friedl (published by O'Reilly, ISBN
1556592-257-3).
AUTHOR AND COPYRIGHT
Copyright (c) 2000 Mark Kvale All rights reserved.
This document may be distributed under the same terms as
Perl itself.
perl v5.8.8 2006-06-30 49
PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)
Acknowledgments
The inspiration for the stop codon DNA example came from the
ZIP code example in chapter 7 of Mastering Regular Expres-
sions.
The author would like to thank Jeff Pinyan, Andrew Johnson,
Peter Haworth, Ronald J Kimball, and Joe Smith for all their
helpful comments.
perl v5.8.8 2006-06-30 50