Bio::Tools::Analysis::User:Contributed)Bio::Tools::Analysis::DNA::ESEfinder(3)NAMEBio::Tools::Analysis::DNA::ESEfinder - a wrapper around ESEfinder
server
SYNOPSIS
use Bio::Tools::Analysis::DNA::ESEfinder;
use strict;
my $seq; # a Bio::PrimarySeqI or Bio::SeqI object
$seq = Bio::Seq->new(
-primary_id => 'test',
-seq=>'atgcatgctaggtgtgtgttttgtgggttgtactagctagtgat'.
-alphabet=>'dna');
my $ese_finder = Bio::Tools::Analysis::DNA::ESEfinder->
new(-seq => $seq);
# run ESEfinder prediction on a DNA sequence
$ese_finder->run();
die "Could not get a result"
unless $ese_finder->status =~ /^COMPLETED/;
print $ese_finder->result; # print raw prediction to STDOUT
foreach my $feat ( $ese_finder->result('Bio::SeqFeatureI') ) {
# do something to SeqFeature
# e.g. print as GFF
print $feat->gff_string, "\n";
# or store within the sequence - if it is a Bio::SeqI
$seq->add_SeqFeature($feat)
}
DESCRIPTION
This class is a wrapper around the ESEfinder web server which uses
experimentally defined scoring matrices to identify possible exonic
splicing enhancers in human transcripts.
The results can be retrieved in 4 ways.
1. "$ese_finder->result('')" retrieves the raw text output of the
program
2. "$ese_finder->result('all')" returns a Bio::Seq::Meta::Array object
with prediction scores for all residues in the sequence
3. "$ese_finder->result('Bio::SeqFeatureI')" returns an array of
Bio::SeqFeature objects for sequences with significant scores.
Feature tags are score, motif, SR_protein and method
4. "$ese_finder->result('raw')" returns an array of significant
matches with each element being a reference to [SR_protein,
position, motif, score]
See <http://rulai.cshl.edu/tools/ESE2/>
This the second implentation of Bio::SimpleAnalysisI which hopefully
will make it easier to write wrappers on various services. This class
uses a web resource and therefore inherits from Bio::WebAgent.
SEE ALSO
Bio::SimpleAnalysisI, Bio::WebAgent
FEEDBACK
Mailing Lists
User feedback is an integral part of the evolution of this and other
Bioperl modules. Send your comments and suggestions preferably to one
of the Bioperl mailing lists. Your participation is much appreciated.
bioperl-l@bioperl.org - General discussion
http://bioperl.org/wiki/Mailing_lists - About the mailing lists
Support
Please direct usage questions or support issues to the mailing list:
bioperl-l@bioperl.org
rather than to the module maintainer directly. Many experienced and
reponsive experts will be able look at the problem and quickly address
it. Please include a thorough description of the problem with code and
data examples if at all possible.
Reporting Bugs
Report bugs to the Bioperl bug tracking system to help us keep track
the bugs and their resolution. Bug reports can be submitted via the
web:
http://bugzilla.open-bio.org/
AUTHORS
Richard Adams, Richard.Adams@ed.ac.uk, Heikki Lehvaslaiho, heikki-at-
bioperl-dot-org
APPENDIX
The rest of the documentation details each of the object methods.
Internal methods are usually preceded with a _
perl v5.14.12011-Bio::Tools::Analysis::DNA::ESEfinder(3)
