Bio::Perl man page on Fedora

Man page or keyword search:  
man Server   31170 pages
apropos Keyword Search (all sections)
Output format
Fedora logo
[printable version]

Bio::Perl(3)	      User Contributed Perl Documentation	  Bio::Perl(3)

NAME
       Bio::Perl - Functional access to BioPerl for people who don't know
       objects

SYNOPSIS
	 use Bio::Perl;

	 # will guess file format from extension
	 $seq_object = read_sequence($filename);

	 # forces genbank format
	 $seq_object = read_sequence($filename,'genbank');

	 # reads an array of sequences
	 @seq_object_array = read_all_sequences($filename,'fasta');

	 # sequences are Bio::Seq objects, so the following methods work
	 # for more info see Bio::Seq, or do 'perldoc Bio/Seq.pm'

	 print "Sequence name is ",$seq_object->display_id,"\n";
	 print "Sequence acc  is ",$seq_object->accession_number,"\n";
	 print "First 5 bases is ",$seq_object->subseq(1,5),"\n";

	 # get the whole sequence as a single string

	 $sequence_as_a_string = $seq_object->seq();

	 # writing sequences

	 write_sequence(">$filename",'genbank',$seq_object);

	 write_sequence(">$filename",'genbank',@seq_object_array);

	 # making a new sequence from just a string

	 $seq_object = new_sequence("ATTGGTTTGGGGACCCAATTTGTGTGTTATATGTA",
	     "myname","AL12232");

	 # getting a sequence from a database (assumes internet connection)

	 $seq_object = get_sequence('swissprot',"ROA1_HUMAN");

	 $seq_object = get_sequence('embl',"AI129902");

	 $seq_object = get_sequence('genbank',"AI129902");

	 # BLAST a sequence (assummes an internet connection)

	 $blast_report = blast_sequence($seq_object);

	 write_blast(">blast.out",$blast_report);

DESCRIPTION
       Easy first time access to BioPerl via functions.

FEEDBACK
   Mailing Lists
       User feedback is an integral part of the evolution of this and other
       Bioperl modules. Send your comments and suggestions preferably to one
       of the Bioperl mailing lists.  Your participation is much appreciated.

	 bioperl-l@bioperl.org

   Support
       Please direct usage questions or support issues to the mailing list:

       bioperl-l@bioperl.org

       rather than to the module maintainer directly. Many experienced and
       reponsive experts will be able look at the problem and quickly address
       it. Please include a thorough description of the problem with code and
       data examples if at all possible.

   Reporting Bugs
       Report bugs to the Bioperl bug tracking system to help us keep track
       the bugs and their resolution. Bug reports can be submitted via the
       web:

	 http://bugzilla.open-bio.org/

AUTHOR - Ewan Birney
       Email birney@ebi.ac.uk

APPENDIX
       The rest of the documentation details each of the object methods.
       Internal methods are usually preceded with a _

   read_sequence
	Title	: read_sequence
	Usage	: $seq = read_sequence('sequences.fa')
		  $seq = read_sequence($filename,'genbank');

		  # pipes are fine
		  $seq = read_sequence("my_fetching_program $id |",'fasta');

	Function: Reads the top sequence from the file. If no format is given, it will
		  try to guess the format from the filename. If a format is given, it
		  forces that format. The filename can be any valid perl open() string
		  - in particular, you can put in pipes

	Returns : A Bio::Seq object. A quick synopsis:
		  $seq_object->display_id - name of the sequence
		  $seq_object->seq	  - sequence as a string

	Args	: Two strings, first the filename - any Perl open() string is ok
		  Second string is the format, which is optional

       For more information on Seq objects see Bio::Seq.

   read_all_sequences
	Title	: read_all_sequences
	Usage	: @seq_object_array = read_all_sequences($filename);
		  @seq_object_array = read_all_sequences($filename,'genbank');

	Function: Just as the function above, but reads all the sequences in the
		  file and loads them into an array.

		  For very large files, you will run out of memory. When this
		  happens, you've got to use the SeqIO system directly (this is
		  not so hard! Don't worry about it!).

	Returns : array of Bio::Seq objects

	Args	: two strings, first the filename (any open() string is ok)
		  second the format (which is optional)

       See Bio::SeqIO and Bio::Seq for more information

   write_sequence
	Title	: write_sequence
	Usage	: write_sequence(">new_file.gb",'genbank',$seq)
		  write_sequence(">new_file.gb",'genbank',@array_of_sequence_objects)

	Function: writes sequences in the specified format

	Returns : true

	Args	: filename as a string, must provide an open() output file
		  format as a string
		  one or more sequence objects

   new_sequence
	Title	: new_sequence
	Usage	: $seq_obj = new_sequence("GATTACA", "kino-enzyme");

	Function: Construct a sequency object from sequence string
	Returns : A Bio::Seq object

	Args	: sequence string
		  name string (optional, default "no-name-for-sequence")
		  accession - accession number (optional, no default)

   blast_sequence
	Title	: blast_sequence
	Usage	: $blast_result = blast_sequence($seq)
		  $blast_result = blast_sequence('MFVEGGTFASEDDDSASAEDE');

	Function: If the computer has Internet accessibility, blasts
		  the sequence using the NCBI BLAST server against nrdb.

		  It chooses the flavour of BLAST on the basis of the sequence.

		  This function uses Bio::Tools::Run::RemoteBlast, which itself
		  use Bio::SearchIO - as soon as you want to know more, check out
		  these modules
	Returns : Bio::Search::Result::GenericResult.pm

	Args	: Either a string of protein letters or nucleotides, or a
		  Bio::Seq object

   write_blast
	Title	: write_blast
	Usage	: write_blast($filename,$blast_report);

	Function: Writes a BLAST result object (or more formally
		  a SearchIO result object) out to a filename
		  in BLAST-like format

	Returns : none

	Args	: filename as a string
		  Bio::SearchIO::Results object

   get_sequence
	Title	: get_sequence
	Usage	: $seq_object = get_sequence('swiss',"ROA1_HUMAN");

	Function: If the computer has Internet access this method gets
		  the sequence from Internet accessible databases. Currently
		  this supports Swissprot ('swiss'), EMBL ('embl'), GenBank
		  ('genbank'), GenPept ('genpept'), and RefSeq ('refseq').

		  Swissprot and EMBL are more robust than GenBank fetching.

		  If the user is trying to retrieve a RefSeq entry from
		  GenBank/EMBL, the query is silently redirected.

	Returns : A Bio::Seq object

	Args	: database type - one of swiss, embl, genbank, genpept, or
		  refseq

   translate
	Title	: translate
	Usage	: $seqobj = translate($seq_or_string_scalar)

	Function: translates a DNA sequence object OR just a plain
		  string of DNA to amino acids
	Returns : A Bio::Seq object

	Args	: Either a sequence object or a string of
		  just DNA sequence characters

   translate_as_string
	Title	: translate_as_string
	Usage	: $seqstring = translate_as_string($seq_or_string_scalar)

	Function: translates a DNA sequence object OR just a plain
		  string of DNA to amino acids
	Returns : A string of just amino acids

	Args	: Either a sequence object or a string of
		  just DNA sequence characters

   reverse_complement
	Title	: reverse_complement
	Usage	: $seqobj = reverse_complement($seq_or_string_scalar)

	Function: reverse complements a string or sequence argument
		  producing a Bio::Seq - if you want a string, you
		  can use reverse_complement_as_string
	Returns : A Bio::Seq object

	Args	: Either a sequence object or a string of
		  just DNA sequence characters

   revcom
	Title	: revcom
	Usage	: $seqobj = revcom($seq_or_string_scalar)

	Function: reverse complements a string or sequence argument
		  producing a Bio::Seq - if you want a string, you
		  can use reverse_complement_as_string

		  This is an alias for reverse_complement
	Returns : A Bio::Seq object

	Args	: Either a sequence object or a string of
		  just DNA sequence characters

   reverse_complement_as_string
	Title	: reverse_complement_as_string
	Usage	: $string = reverse_complement_as_string($seq_or_string_scalar)

	Function: reverse complements a string or sequence argument
		  producing a string
	Returns : A string of DNA letters

	Args	: Either a sequence object or a string of
		  just DNA sequence characters

   revcom_as_string
	Title	: revcom_as_string
	Usage	: $string = revcom_as_string($seq_or_string_scalar)

	Function: reverse complements a string or sequence argument
		  producing a string
	Returns : A string of DNA letters

	Args	: Either a sequence object or a string of
		  just DNA sequence characters

perl v5.14.1			  2011-07-22			  Bio::Perl(3)
[top]

List of man pages available for Fedora

Copyright (c) for man pages and the logo by the respective OS vendor.

For those who want to learn more, the polarhome community provides shell access and support.

[legal] [privacy] [GNU] [policy] [cookies] [netiquette] [sponsors] [FAQ]
Tweet
Polarhome, production since 1999.
Member of Polarhome portal.
Based on Fawad Halim's script.
....................................................................
Vote for polarhome
Free Shell Accounts :: the biggest list on the net