Bio::DB::Bam::Alignment man page on Pidora

Man page or keyword search:  
man Server   31170 pages
apropos Keyword Search (all sections)
Output format
Pidora logo
[printable version]

Bio::DB::Bam::AlignmenUser Contributed Perl DocumentBio::DB::Bam::Alignment(3)

NAME
       Bio::DB::Bam::Alignment -- The SAM/BAM alignment object

SYNOPSIS
	use Bio::DB::Sam;

	my $sam = Bio::DB::Sam->new(-fasta=>"data/ex1.fa",
				    -bam  =>"data/ex1.bam");

	my @alignments = $sam->get_features_by_location(-seq_id => 'seq2',
							-start	=> 500,
							-end	=> 800);
	for my $a (@alignments) {
	   my $seqid  = $a->seq_id;
	   my $start  = $a->start;
	   my $end    = $a->end;
	   my $strand = $a->strand;
	   my $ref_dna= $a->dna;

	   my $query_start  = $a->query->start;
	   my $query_end    = $a->query->end;
	   my $query_strand = $a->query->strand;
	   my $query_dna    = $a->query->dna;

	   my $cigar	 = $a->cigar_str;
	   my @scores	 = $a->qscore;	   # per-base quality scores
	   my $match_qual= $a->qual;	   # quality of the match

	   my $paired = $a->get_tag_values('PAIRED');
	}

DESCRIPTION
       The Bio::DB::Bam::Alignment and Bio::DB::Bam::AlignWrapper classes
       together represent an alignment between a sequence read (the "query")
       and a reference sequence (the "target"). Bio::DB::Bam::Alignment
       adheres strictly to the C-level BAM library's definition of a bam1_t*
       and is used in the Bio::DB::Sam low-level API The latter adds
       convenience methods that make it similar to a BioPerl Bio::SeqFeatureI
       object. This manual page describes both.

High-level Bio::DB::Bam::Alignment methods
       These methods are provided by Bio::DB::Bam::Alignment, and are intended
       to be compatible with the Bio::SeqFeatureI interfaces. Note that these
       objects are not compatible with Bio::Align::AlignI, as the BAM API is
       fundamentally incompatible with the BioPerl API for alignments (the
       first deals with the alignment of a single read against the reference
       sequence, while the second deals with a multiple alignment).

       Note that the high-level API return Bio::DB::Bam::AlignWrapper objects
       except in the case of the callback to the fast_pileup() method. In this
       case only, the object returned by calling $pileup->b() is a
       Bio::DB::Bam::Alignment object for performance reasons.

       $seq_id = $align->seq_id
	   Return the seq_id of the reference (target) sequence. This method
	   is only available in the Bio::DB::Bam::AlignWrapper extension.

       $start = $align->start
	   Return the start of the alignment in 1-based reference sequence
	   coordinates.

       $end = $align->end
	   Return the end of the alignment in 1-based reference sequence
	   coordinates.

       $len = $align->length
	   Return the length of the alignment on the reference sequence.

       $mseqid = $align->mate_seq_id
	   Return the seq_id of the mate's reference (target) sequence. This
	   method is only available in the Bio::DB::AlignWrapper extension.

       $mstart = $align->mate_start
	   For paired reads, return the start of the mate's alignment in
	   1-based reference sequence coordinates.

       $mend = $align->mate_end
	   For paired reads, return the end position of the mate's alignment
	   in 1-based reference sequence coordinates.

       $mlen = $align->mate_len
	   For mate-pairs, retrieve the length of the mate's alignment on the
	   reference sequence.

       $strand = $align->strand
	   Return the strand of the alignment as -1 for reversed, +1 for
	   forward.

	   NOTE: In versions 1.00-1.06, this method always returned +1. As of
	   version 1.07, this behavior is fixed.

       $mstrand = $align->mstrand
	   If the read has a mate pair, return the strand of the mate in the
	   format -1 or +1.

       $ref_dna	       = $align->dna
	   Returns the reference sequence's DNA across the aligned region. If
	   an MD tag is present in the alignment, it will be used
	   preferentially to reconstruct the reference sequence. Otherwise the
	   reference DNA access object passed to Bio::DB::Sam->new() will be
	   used.

       $ref_dna	       = $align->seq
	   The reference sequence's DNA as a Bio::PrimarySeqI object (useful
	   for passing to BioPerl functions and for calculating subsequences
	   and reverse complements).

       $query = $align->query
	   This method returns a Bio::DB::Alignment::Query object that can be
	   used to retrieve information about the query sequence. The next few
	   entries show how to use this object.

       $read_name = $align->query->name
	   The name of the read.

       $q_start	  = $align->query->start
	   This returns the start position of the query (read) sequence in
	   1-based coordinates. It acts via a transient Bio::DB::Bam::Query
	   object that is provided for Bio::Graphics compatibility (see
	   Bio::Graphics).

       $q_end	  = $align->query->end
	   This returns the end position of the query sequence in 1-based
	   coordinates.

       $q_len	  = $align->query->length
	   Return the length of the alignment on the read.

       $scores = $align->query->score
	   Return an array reference containing the unpacked quality scores
	   for each base of the query sequence. The length of this array
	   reference will be equal to the length of the read.

       $read_dna = $align->query->dna
	   The read's DNA string.

       $read_seq = $align->query->seq
	   The read's DNA as a Bio::PrimarySeqI object.

       $target	= $align->target;
	   The target() method is similar to query(), except that it follows
	   Bio::AlignIO conventions for how to represent minus strand
	   alignments. The object returned has start(), end(), qscore(), dna()
	   and seq() methods, but for minus strand alignments the sequence
	   will be represented as it appears on the reverse strand, rather
	   than on the forward strand. This has the advantage of giving you
	   the read as it came off the machine, before being reverse
	   complemented for use in the SAM file.

       $query	= $align->hit
	   The hit() method is identical to target() and returns information
	   about the read. It is present for compatibility with some of the
	   Bio::Graphics glyphs, which use hit() to represent the non-
	   reference sequence in aligned sequences.

       $primary_id = $align->primary_id
	   This method synthesizes a unique ID for the alignment which can be
	   passed to $sam->get_feature_by_id() to retrieve the alignment at a
	   later date.

       @tags = $align->get_all_tags
	   Return all tag names known to this alignment. This includes SAM
	   flags such as M_UNMAPPED, as well as auxiliary flags such as H0.
	   The behavior of this method depends on the value of -expand_flags
	   when the SAM object was created. If false (the default), then the
	   standard SAM flags will be concatenated together into a single
	   string and stored in a tag named 'FLAGS'. The format of this tag
	   value is the list of one or more flag constants separated by the
	   "|" character, as in: "PAIRED|MAP_PAIR|REVERSED|SECOND_MATE". If
	   -expand_flags was true, then each flag becomes its own named tag,
	   such as "MAP_PAIR".

       @values = $align->get_tag_values($tag)
	   Given a tag name, such as 'PAIRED' or 'H0', return its value(s).
	   -expand_flags must be true in order to use the standard SAM flag
	   constants as tags. Otherwise, they can be fetched by asking for the
	   "FLAGS" tag, or by using the low-level methods described below.

       $is_true = $align->has_tag($tag)
	   Return true if the alignment has the indicated tag.

       $string = $align->cigar_str
	   Return the CIGAR string for this alignment in conventional human
	   readable format (e.g. "M34D1M1").

       $arrayref = $align->cigar_array
	   Return a reference to an array representing the CIGAR string. This
	   is an array of arrays, in which each subarray consists of a CIGAR
	   operation and a count. Example:

	    [ ['M',34], ['D',1], ['M1',1] ]

       ($ref,$matches,$query) = $align->padded_alignment
	   Return three strings that show the alignment between the reference
	   sequence (the target) and the query. It will look like this:

	    $ref     AGTGCCTTTGTTCA-----ACCCCCTTGCAACAACC
	    $matches ||||||||||||||	|||||||||||||||||
	    $query   AGTGCCTTTGTTCACATAGACCCCCTTGCAACAACC

       $str = $align->aux
	   Returns the text version of the SAM tags, e.g.  "XT:A:M NM:i:2
	   SM:i:37 AM:i:37 XM:i:1 XO:i:1 XG:i:1 MD:Z:6^C0A47"

       $str = $align->tam_line
	   Returns the TAM (text) representation of the alignment (available
	   in the high-level "AlignWrapper" interface only).

       $tag = $align->primary_tag
	   This is provided for Bio::SeqFeatureI compatibility. Return the
	   string "match".

       $tag = $align->source_tag
	   This is provided for Bio::SeqFeatureI compatibility. Return the
	   string "sam/bam".

       @parts = $align->get_SeqFeatures
	   Return subfeatures of this alignment. If you have fetched a
	   "read_pair" feature, this will be the two mate pair objects (both
	   of type Bio::DB::Bam::AlignWrapper). If you have -split_splices set
	   to true in the Bio::DB::Sam database, calling get_SeqFeatures()
	   will return the components of split alignments. See "Bio::DB::Sam
	   Constructor and basic accessors" in Bio::DB::Sam for an example of
	   how to use this.

Low-level Bio::DB::Bam::Alignment methods
       These methods are available to objects of type Bio::DB::Bam::Alignment
       as well as Bio::DB::Bam::AlignWrapper and closely mirror the native C
       API.

       $align = Bio::DB::Bam::Alignment->new
	   Create a new, empty alignment object. This is usually only needed
	   when iterating through a TAM file using Bio::DB::Tam->read1().

       $tid = $align->tid( [$new_tid] )
	   Return the target ID of the alignment. Optionally you may change
	   the tid by providing it as an argument (currently this is the only
	   field that you can change; the functionality was implemented as a
	   proof of principle).

       $read_name = $align->qname
	   Returns the name of the read.

       $pos = $align->pos
	   0-based leftmost coordinate of the aligned sequence on the
	   reference sequence.

       $end = $align->calend
	   The 0-based rightmost coordinate of the aligned sequence on the
	   reference sequence after taking alignment gaps into account.

       $len = $align->cigar2qlen
	   The length of the query sequence calculated from the CIGAR string.

       $quality = $align->qual
	   The quality score for the alignment as a whole.

       $flag = $align->flag
	   The bitwise flag field (see the SAM documentation).

       $mtid = $align->mtid
	   For paired reads, the target ID of the mate's alignemnt.

       $mpos = $align->mpos
	   For paired reads, the 0-based leftmost coordinate of the mate's
	   alignment on the reference sequence.

       $n_cigar = $align->n_cigar
	   Number of CIGAR operations in this alignment.

       $length = $align->l_qseq
	   The length of the query sequence (the read).

       $dna = $align->qseq
	   The actual DNA sequence of the query. As in the SAM file, reads
	   that are aligned to the minus strand of the reference are returned
	   in reverse complemented form.

       $score_str = $align->_qscore
	   A packed binary string containing the quality scores for each base
	   of the read. It will be the same length as the DNA. You may unpack
	   it using unpack('C*',$score_str), or use the high-level qscore()
	   method.

       $score_arry = $align->qscore
       @score_arry = $align->qscore
	   In a scalar context return an array reference containing the
	   unpacked quality scores for each base of the query sequence. In a
	   list context return a list of the scores. This array is in the same
	   orientation as the reference sequence.

       $length = $align->isize
	   The calculated insert size for mapped paired reads.

       $length = $align->l_aux
	   The length of the align "auxiliary" data.

       $value = $align->aux_get("tag")
	   Given an auxiliary tag, such as "H0", return its value.

       @keys  = $align->aux_keys
	   Return the list of auxiliary tags known to this alignment.

       $data = $align->data
	   Return a packed string containing the alignment data (sequence,
	   quality scores and cigar string).

       $length = $align->data_len
	   Return the current length of the alignment data.

       $length = $align->m_data
	   Return the maximum length of the alignment data.

       $is_paired = $align->paired
	   Return true if the aligned read is part of a mate/read pair
	   (regardless of whether the mate mapped).

       $is_proper = $align->proper_pair
	   Return true if the aligned read is part of a mate/read pair and
	   both partners mapped to the reference sequence.

       $is_unmapped = $align->unmapped
	   Return true if the read failed to align.

       $mate_is_unmapped = $align->munmapped
	   Return true if the read's mate failed to align.

       $reversed = $align->reversed
	   Return true if the aligned read was reverse complemented prior to
	   aligning.

       $mate_reversed = $align->mreversed
	   Return true if the aligned read's mate was reverse complemented
	   prior to aligning.

       $isize = $align->isize
	   For mate-pairs, return the computed insert size.

       $arrayref = $align->cigar
	   This returns the CIGAR data in its native BAM format. You will
	   receive an arrayref in which each operation and count are packed
	   together into an 8-bit structure. To decode each element you must
	   use the following operations:

	    use Bio::DB::Sam::Constants;
	    my $c   = $align->cigar;
	    my $op  = $c->[0] & BAM_CIGAR_MASK;
	    my $len = $c->[0] >> BAM_CIGAR_SHIFT;

SEE ALSO
       Bio::Perl, Bio::DB::Sam, Bio::DB::Bam::Constants

AUTHOR
       Lincoln Stein <lincoln.stein@oicr.on.ca>.  <lincoln.stein@bmail.com>

       Copyright (c) 2009 Ontario Institute for Cancer Research.

       This package and its accompanying libraries is free software; you can
       redistribute it and/or modify it under the terms of the GPL (either
       version 1, or at your option, any later version) or the Artistic
       License 2.0.  Refer to LICENSE for the full license text. In addition,
       please see DISCLAIMER.txt for disclaimers of warranty.

perl v5.14.2			  2012-08-23	    Bio::DB::Bam::Alignment(3)
[top]

List of man pages available for Pidora

Copyright (c) for man pages and the logo by the respective OS vendor.

For those who want to learn more, the polarhome community provides shell access and support.

[legal] [privacy] [GNU] [policy] [cookies] [netiquette] [sponsors] [FAQ]
Tweet
Polarhome, production since 1999.
Member of Polarhome portal.
Based on Fawad Halim's script.
....................................................................
Vote for polarhome
Free Shell Accounts :: the biggest list on the net